BASIC TEXT SEARCH Select your search field from the pull-down menu, enter your search term in the adjacent window and click the "Submit Query" button. The "Mutation Names" search will look for a match in cDNA, protein, or legacy name. You can also search all fields by selecting "All Fields". For advanced search click on the "Advanced Search" button below.

Search:


SEARCH TIPS
  • Search is case insensitive.
  • Search term can consist of a whole word or part of a word e.g.
    • Searching for "551" in the Protein Name field will retrieve all mutations that alter the protein at position 551.
    • Searching for "del" in Mutation Names will retrieve all deletion mutations (but it may take awhile).


cDNA Name Protein Name Legacy Name Region Description Consequence
c.-887_- 885delCTC - 816delCTC promoter deletion of CTC at - 816 promoter mutation original mapping was incorrect
c.-603_-601delAAG - 471delAGG promoter deletion of AGG from - 471 promoter mutation
c.-9_14del23 124del23bp promoter delete 23 bp from 124 to 146 5UTR-exon1 mutation
c.1A>C p.Met1Leu M1L exon 1 A to C at 133 Met to Leu at 1
c.1A>G p.Met1Val M1V exon 1 A to G at 133 no translation initiation
c.2T>A p.Met1Lys M1K exon 1 T to A at 134 no translation initiation
c.3_122del120ins300 135del120ins300 exon 1
c.3G>A p.Met1Ile M1I(ATA) exon 1 G to A at 135 no translation initiation
c.3G>T p.Met1Ile M1I(ATT) exon 1 G to T at 135 no translation initiation
c.4C>T p.Gln2X Q2X (together with R3W) exon 1 C to T at 136 and A to T at 139 Gln to Stop at codon 2 and Arg to Trp at codon 3
c.14C>T p.Pro5Leu P5L exon 1 C to T at 146 Pro to Leu at 5
c.19G>T p.Glu7X E7X exon 1 G to T at 151 Glu to Stop at 7
c.31G>A p.Val11Ile 163G/A exon 1 G or A at 163 sequence variation
c.35_36insTATCA p.Ser13IlefsX14 exon 1
c.42delA p.Lys14AsnfsX11 174delA exon 1 deletion of A between 172- 174 frameshift
c.40A>T p.Lys14X K14X exon 1 A to T at 172 Lys to Stop at 14
c.43delC p.Leu15PhefsX10 175delC exon 1 deletion of C at 175 frameshift
c.43_44insT p.Ser18GlnfsX27 175insT exon 1 insertion of T after 175 frameshift
c.44T>C p.Leu15Pro L15P exon 1 T to C at 176 Leu to Pro at 15
c.49_50dupTT p.Trp19AlafsX7 exon 1
c.50delT p.Phe17SerfsX8 182delT exon 1 deletion of T at 182 frameshift
c.52A>G p.Ser18Gly S18G exon 1 A to G at 184 Ser to Gly at 18
c.54-1161_164+1603del2875 CFTR- dele2 intron 1 186- 1161_296+ 1603del2875 Large in frame deletion removing exon2
c.72G>C p.Leu24Phe L24F exon 2 G to C at 204 Leu to Phe at 24
c.76A>G p.Lys26Glu exon 3
c.80delG p.Gly27AspfsX64 211delG exon 2 deletion of G at 211 frameshift
c.79G>A p.Gly27Arg G27R exon 2 G to A at 211 Gly to Arg at 27
c.79G>C p.Gly27Arg G27R(211G to C) exon 2 G to C at 211 Gly to Arg at 27
c.79G>T p.Gly27X G27X exon 2 G to T at 211 Gly to Stop at 27
c.80G>A p.Gly27Glu G27E exon 2 G to A at 212 Gly to Glu at 27
c.88C>T p.Gln30X Q30X exon 2 C to T at 220 Gln to Stop at 30
c.92G>T p.Arg31Leu R31L exon 2 G to T at 224 Arg to Leu at 31
c.95T>C p.Leu32Pro exon 2
c.100_117delTTGTCAGACATATACCAA p.Leu34_Gln39del 232del18 exon 2 Deletion of 18 bp from 232 Deletion of 6 aa from Leu34 to Gln39
c.111_112delAT p.Tyr38ProfsX6 241delAT exon 2 deletion of AT from 241 frameshift
c.109A>G p.Ile37Val exon 2
c.112_113delTA p.Tyr38ProfsX6 244delTA exon 2 deletion of TA from 244 frameshift
c.115C>T p.Gln39X Q39X exon 2 C to T at 247 Gln to Stop at 39
c.131A>T p.Asp44Val 263A/T exon 2 A or T at 263 sequence variation
c.131A>G p.Asp44Gly D44G exon 2 A to G at 263 Asp to Gly at 44
c.137C>A p.Ala46Asp A46D exon 2 C to A at 269 Ala to Asp at 46
c.137C>T p.Ala46Val A46V exon 2 C to T at 269
c.156delA p.Lys52AsnfsX39 284delA exon 2 deletion of A at 284 frameshift
c.164G>A p.Arg55Lys R55K exon 2 G to A at 296 Arg to Lys at 55
c.166G>A p.Glu56Lys E56K exon 3 G to A at 298 Glu to Lys at 56
c.168delA p.Glu56AspfsX35 300delA exon 3 deletion of A at 300 frameshift
c.169T>G p.Trp57Gly W57G exon 3 T to G at 301 Trp to Gly at 57
c.173A>G p.Asp58Gly D58G exon 3 A to G at 305 Asp to Gly at 58
c.174_177delTAGA p.Asp58GlufsX32 306delTAGA exon 3 deletion of TAGA from 306 frameshift
c.174_175insA p.Arg59LysfsX10 306insA exon 3 insertion of A at 306 frameshift
c.178G>A p.Glu60Lys E60K exon 3 G to A at 310 Glu to Lys at 60
c.178G>T p.Glu60X E60X exon 3 G to T at 310 Glu to Stop at 60
c.182T>C p.Leu61Pro L61P exon 3 T to C at 314 Leucine to Proline at position 61
c.190A>G p.Lys64Glu K64E exon 3 A to G at 322 Lys tu Glu at 64
c.200C>T p.Pro67Leu P67L exon 3 C to T at 332 Pro to Leu at 67
c.202A>G p.Lys68Glu K68E exon 3 A to G at 334 Lys to Glu at 68
c.204A>T p.Lys68Asn K68N exon 3 A to T at 336 Lys to Asn at 68
c.206T>G p.Leu69Arg exon 3
c.214G>A p.Ala72Thr A72T exon 3 G to A at 346 Ala to Thr at 72
c.217delC p.Leu73PhefsX18 347delC exon 3 deletion of C at 347 frameshift
c.215C>A p.Ala72Asp A72D exon 3 C to A at 347 Ala to Asp at 72
c.221G>A p.Arg74Gln R74Q exon 3 G to A at 353 Arg to Gln at 74
c.224G>T p.Arg75Leu R75L exon 3 G to T at 356 Arg to Leu at 75
c.224G>A p.Arg75Gln R75Q exon 3 G or A at 356 sequence variation
c.227_228insT p.Trp79LeufsX32 359insT exon 3 insertion of T after 359 frameshift
c.233delT p.Phe78SerfsX13 360delT exon 3 deletion of T at 360 frameshift
c.233_234insT p.Trp79LeufsX32 365- 366insT (W79fs) exon 3 insertion at 360 - 365 Frameshift (W79fs)
c.228_229insT p.Trp79LeufsX32 360- 365insT exon 3 Insertion of T at 360- 365 Frameshift
c.234delC p.Trp79GlyfsX12 exon 3
c.244A>G p.Met82Val M82V exon 3 A to G at 376 Met to Val at 82
c.247_248insT p.Tyr84LeufsX27 379- 381insT exon 3 Insertion of T at 379- 381 Frameshift
c.254G>T p.Gly85Val G85V exon 3 G to T at 386 Gly to Val at 85
c.254G>A p.Gly85Glu G85E exon 3 G to A at 386 Gly to Glu at 85
c.259T>C p.Phe87Leu F87L exon 3 T to C at 391 Phe to Leu at 87
c.259T>A p.Phe87Ile exon 3
c.262_263delTT p.Leu88IlefsX22 394delTT exon 3 deletion of TT from 394 frameshift
c.263T>G p.Leu88X L88X(T- >G) exon 3 T to G at 395 Leu to Stop at 88
c.263T>C p.Leu88Ser L88S exon 3 T to C at 395 Leu to Ser at 88
c.263T>A p.Leu88X L88X(T- >A) exon 3 T to A at 395 Leu to Stop at 88
c.264_268delATATT p.Leu88PhefsX21 exon 3
c.269T>C p.Leu90Ser L90S exon 3 T to C at 401 Leu to Ser at 90
c.271G>A p.Gly91Arg G91R exon 3 G to A at 403 Gly to Arg at 91
c.273+10255delC 405+ 10255delC intron 3 405+ 10255delC
c.274G>A p.Glu92Lys E92K exon 4 G to A at 406 Glu to Lys at 92
c.274G>T p.Glu92X E92X exon 4 G to T at 406 Glu to Stop at 92
c.276A>T p.Glu92Asp E92D exon 4 A to T at 408(GAA- >GAT) Gly to Asp at 92
c.278T>A p.Val93Asp exon 4
c.280_286delACCAAAG p.Thr94GlnfsX11 412del7- >TA exon 4 deletion of ACCAAAG from 412 and insertion of TA frameshift
c.287C>A p.Ala96Glu A96E exon 4 C to A at 419 Ala to Glu at 96
c.292C>T p.Gln98X Q98X exon 4 C to T at 424 Gln to Stop at 98 (Pakistani specific?)
c.293A>G p.Gln98Arg Q98R exon 4 A to G at 425 Gln to Arg at 98
c.293A>C p.Gln98Pro Q98P exon 4 A to C at 425 Gln to Pro at 98
c.296C>T p.Pro99Leu P99L exon 4 C to T at 428 Pro to Leu at 99
c.302T>G p.Leu101X L101X exon 4 T to G at 434 Leu to Stop at 101
c.302T>C p.Leu101Ser L101S exon 4 T to C at 434 Leu to Ser at 101
c.303_304insA p.Leu102ThrfsX9 435insA exon 4 insertion of A after 435 frameshift
c.305T>C p.Leu102Pro L102P exon 4 T to C at 437 Leu to Pro at 102
c.305T>G p.Leu102Arg L102R exon 4 T to G at 437 Leu to Arg at 102
c.307G>T p.Gly103X G103X exon 4 G to T at 439 Gly to Stop at 103
c.310delA p.Arg104GlufsX3 441delA exon 4 deletion of A at 441 and T to A at 486 frameshift
c.313delA p.Ile105SerfsX2 444delA exon 4 deletion of A at 444 frameshift
c.314T>A p.Ile105Asn I105N exon 4 T to A at 446 Ile to Asn at 105
c.319_326delGCTTCCTA p.Ala107X 451del8 exon 4 deletion of GCTTCCTA from 451 frameshift
c.320C>G p.Ala107Gly A107G exon 4 C to G at 452 Ala to Gly at 107
c.325_327delTATinsG p.Tyr109GlyfsX4 457TAT- >G exon 4 TAT to G at 457 frameshift
c.326_327delAT p.Tyr109X 458delAT exon 4 deletion of AT at 458 frameshift
c.328delG p.Asp110ThrfsX14 460delG exon 4 deletion of G at 460 frameshift
c.330C>A p.Asp110Glu D110E exon 4 C to A at 462 Asp to Glu at 110
c.331C>G p.Pro111Ala P111A exon 4 C to G at 463 Pro to Ala at 111
c.332C>T p.Pro111Leu P111L exon 4 C to T at 464 Pro to Leu at 111
c.338A>T p.Asn113Ile N113I exon 4 A to T at 470 Asn to Ile
c.340A>T p.Lys114X K114X exon 4 A to T at 472 Lys to Stop at 114
c.343_345del p.Glu115del [delta]E115 exon 4 3 bp deletion of 475- 477 deletion of Glu at 115
c.346G>C p.Glu116Gln E116Q exon 4 G to C at 478 Glu to Gln at 116
c.346G>A p.Glu116Lys E116K exon 4 G to A at 478 Glu to Lys at 116
c.349C>G p.Arg117Gly R117G exon 4 C to G at 481 Arg to Gly at 117
c.350G>T p.Arg117Leu R117L exon 4 G to T at 482 Arg to Leu at 117
c.355A>G p.Ile119Val I119V exon 4 A to G at 487 Iso to Val at 119
c.357delC p.Ile119MetfsX5 489delC exon 4 deletion of C at 489 frameshift
c.358G>A p.Ala120Thr A120T exon 4 G to A at 490 Ala to Thr at 120
c.359C>T p.Ala120Val A120V exon 4 C to T at 491 Ala to Val at 120
c.370G>C p.Gly124Arg G124R exon 4 502G>C
c.374T>C p.Ile125Thr I125T exon 4 T to C at 506 Ile to Thr at 125
c.376G>A p.Gly126Ser exon 4
c.377G>A p.Gly126Asp G126D exon 4 G to A at 509 Gly to Asp at 126
c.379_381dupTTA p.Leu127dup L127dup exon 4 511_513dupTTA
c.380T>G p.Leu127X L127X exon 4 T to G at 512 Leu to Stop at 127
c.387delT p.Leu130SerfsX? 519delT exon 4 T deleted frameshift
c.388C>G p.Leu130Val L130V exon 4 C to G at 520 Leucine to Valine at 130
c.393delT p.Phe131LeufsX3 525delT exon 4 deletion of T at 525 frameshift
c.396T>G p.Ile132Met I132M exon 4 T to G at 528 Ile to Met at 132 (sequence variation?)
c.405_406dupAC p.Leu136HisfsX18 exon 4
c.409delC p.Leu137SerfsX16 541delC exon 4 deletion of C at 541 frameshift
c.409_412delCTCC p.Leu137TyrfsX15 541del4 exon 4 deletion of CTCC from 541 frameshift
c.410T>A p.Leu137His L137H exon 4 T to A at 542 Leu to His at 137
c.410T>C p.Leu137Pro L137P exon 4 T to C at 542 Leu to Pro at 137 (sequence variation?)
c.410T>G p.Leu137Arg L137R exon 4 T to G at 542 Leu to Arg at 137
c.412_413insACT p.Leu137_Leu138insThr L138ins exon 4 insertion of CTA, TAC or ACT at nucleotide 544, 545 or 546 insertion of leucine at 138
c.413T>C p.Leu138Pro 545T/C exon 4 T or C at 545 sequence variation
c.414_415insCTA p.Leu139X 546insCTA exon 4 insertion of CTA at 546 frameshift
c.415_416insTA p.His139LeufsX15 547insTA exon 4 insertion of TA after 547 frameshift
c.416A>T p.His139Leu H139L exon 4 A to T at 548 His to Leu at 139
c.419C>T p.Pro140Leu P140L exon 4 C to T at 551 Pro to Leu at 140
c.420_421insA p.Ala141SerfsX18 552insA exon 4 insertion of A after 552 frameshift
c.422C>A p.Ala141Asp A141D exon 4 C to A at 554 Ala to Asp at 141
c.424delA p.Ile142PhefsX11 556delA exon 4 deletion of A at 556 frameshift
c.429delT p.Phe143LeufsX10 557delT exon 4 deletion of T at 557 frameshift
c.433delC p.Leu145PhefsX8 565delC exon 4 deletion of C at 565 frameshift
c.434T>A p.Leu145His L145H exon 4 T to A at 566 Leu to His at 145
c.442delA p.Ile148LeufsX5 574delA exon 4 deletion of A at 574 frameshift
c.442A>T p.Ile148Phe exon 4
c.443T>A p.Ile148Asn I148N exon 4 T to A at 575 Ile to Asn at 148
c.443T>C p.Ile148Thr I148T exon 4 T to C at 575 Ile to Thr at 148
c.444_445InsCTA p.Leu149ins 576InsCTA exon 4 Insert CTA at 576 In frame in/del
c.445G>A p.Gly149Arg G149R exon 4 G to A at 577 Gly to Arg at 149
c.445G>T p.Gly149X exon 4
c.446G>T p.Gly149Val G149V exon 4 G to T at 578 Gly to Val at 149
c.451C>A p.Gln151Lys Q151K exon 4 C to A at 583 (CAG- >AAG) Gln to Lys at 151
c.451C>T p.Gln151X Q151X exon 4 C to T at 583 Gln to Stop at 151
c.454A>T p.Met152Leu M152L exon 4 A to T at 586 Met to Leu at 152
c.454A>G p.Met152Val M152V exon 4 A to G at 586 Met to Val at 152 (mutation?)
c.459_476delAATAGCTATGTTTAGTTT p.Ala155_Ile160del 591del18 exon 4 deletion of 18 bp from 591 deletion of 6 a.a. from
c.463G>C p.Ala155Pro A155P exon 4 G to C at 595 Ala to Pro at 155
c.473_474insT p.Leu159PhefsX4 605insT exon 4 insertion of T after 605 frameshift
c.476T>C p.Leu159Ser L159S exon 4 T to C at 608 Leu to Ser at 159
c.476T>A p.Leu159X L159X exon 4 T to A at 608 Leu to Stop at 159
c.484A>G p.Lys162Glu K162E exon 4 A to G at 616 Lys to Glu at 162
c.488A>C p.Lys163Thr K163T exon 4 620A>C
c.490A>G p.Thr164Ala T164A exon 5 622A>G
c.494delT p.Leu165X 624delT exon 5 deletion of T at 624 frameshift
c.494T>C p.Leu165Ser L165S exon 5 T to C at 626 Leu to Ser at 165
c.496A>G p.Lys166Glu K166Q exon 5 A to G at 628 Lys to Gln at 166
c.500T>G p.Leu167Arg exon 5
c.508C>G p.Arg170Gly R170G exon 5 C to G at 640 Arg to Gly at 170
c.518_522delATAAA p.Ile175TyrfsX6 650delATAAA exon 5 Deletion of ATAAA at 650 Frameshift
c.523A>G p.Ile175Val I175V exon 5 A to G at 655 Ile to Val at 175
c.526delA p.Ser176ValfsX13 657delA exon 5 deletion of A at 657 frameshift
c.530T>C p.Ile177Thr I177T exon 5 T to C at 662 Ile to Thr at 177
c.531delT p.Ile177MetfsX12 663delT exon 5 deletion of T at 663 frameshift
c.531T>G p.Ile177Met I177M exon 5 663T>G
c.532G>A p.Gly178Arg G178R exon 5 G to A at 664 Gly to Arg at 178
c.533G>A p.Gly178Glu G178E exon 5 G to A at 665 Gly to Glu at 178
c.535C>A p.Gln179Lys Q179K exon 5 C to A at 667 Gln to Lys at 179
c.543_546delTAGT p.Leu183PhefsX5 675del4 exon 5 deletion of TAGT from 675 frameshift
c.544A>G p.Ser182Gly 676A/G exon 5 A or G at 676 sequence variation
c.547C>A p.Leu183Ile L183I exon 5 C to A at 679 Leu to Ile at 183
c.550delC p.Leu184PhefsX5 681delC exon 5 deletion of C at 681 frameshift
c.558C>A p.Asn186Lys N186K exon 5 C to A at 690 Asn to Lys at 186
c.561C>A p.Asn187Lys N187K exon 5 C to A at 693 Asn to Lys at 187
c.567C>A p.Asn189Lys N189K exon 5 C to A at 699 Asn to Lys at 189
c.574_576delGAT p.Asp192del [delta]D192 exon 5 deletion of TGA or GAT from 706 or 707 deletion of Asp at 192
c.575A>G p.Asp192Gly D192G exon 5 A to G at 707 Asp to Gly at 192
c.577G>A p.Glu193Lys E193K exon 5 G to A at 709 Glu to Lys at 193
c.577G>T p.Glu193X E193X exon 5 G to T at 709 Glu to Stop at 193
c.578_579+5delAAGTATG p.Glu193ValfsX20 710_711+ 5del7 exon 5 Deletion of AAGTATG between 710 and 711+ 5
c.580G>A p.Gly194Arg G194R exon 6 G to A at 712 Gly to Arg at 194
c.581G>T p.Gly194Val G194V exon 6 G to T at 713 Gly to Val at 194
c.592G>C p.Ala198Pro A198P exon 6 G to C at 724 Ala to Pro at 198
c.592G>A p.Ala198Thr A198T exon 6 G to A at 724
c.597T>G p.His199Gln H199Q exon 6 T to G at 729 His to Gln at 199
c.598T>A p.Phe200Ile F200I exon 6 T to A at 730 Phe to Ile at 200
c.601delG p.Val201CysfsX14 733delG exon 6 Deletion of G at 733 Frameshift
c.601G>A p.Val201Met V201M exon 6 G to A at 733 Val to Met at 201
c.609C>G p.Ile203Met I203M exon 6 C to G at 741 Ile to Met at 203
c.614C>T p.Pro205Leu exon 6
c.617T>G p.Leu206Trp L206W exon 6 T to G at 749 Leu to Trp at 206
c.618G>T p.Leu206Phe L206F exon 6 G to T at 750 Leu to Phe at 206
c.619C>T p.Gln207X Q207X exon 6 C to T at 751 Gln to Stop at 207
c.625G>T p.Ala209Ser A209S exon 6 G to T at 757 Ala to Ser at 209
c.629T>C p.Leu210Pro L210P exon 6 T to C at 761 Leu to Pro at 210
c.650A>G p.Glu217Gly E217G exon 6 A to G at 782 Glu to Gly at 217
c.650_659delAGTTGTTACA p.Glu217GlyfsX11 exon 6
c.653T>A p.Leu218X L218X exon 6 T to A at 785 Leu to Stop at 218
c.658C>T p.Gln220X Q220X exon 6 C to T at 790 Gln to Stop at 220
c.659A>G p.Gln220Arg Q220R exon 6 A to G at 791 Gln to Arg at 220
c.680T>G p.Leu227Arg L227R exon 6 T to G at 812 Leu to Arg at 227
c.695T>A p.Val232Asp V232D exon 6 T to A at 827 Val to Asp at 232 (CBAVD)
c.697C>T p.Leu233Phe L233F exon 6 829C>T
c.701C>A p.Ala234Asp exon 6
c.708delT p.Gln237ArgfsX4 exon 6
c.709C>G p.Gln237Glu Q237E exon 6 C to G at 841 Gln to Glu at 237
c.711G>C p.Gln237His Q237H exon 6 843G>C
c.713C>T p.Ala238Val A238V exon 6 C to T at 845 Ala to Val at 238
c.714delT p.Leu240X exon 6
c.715G>A p.Gly239Arg G239R exon 6 G to A at 847 Gly to Arg at 239
c.720_741delAGGGAGAATGATGATGAAGTAC p.Gly241GlufsX13 852del22 exon 6 deletion of 22 bp from 852 frameshift
c.721G>A p.Gly241Arg G241R exon 6 G to A at 853 Gly to Arg at 241
c.727A>C p.Met243Leu M243L exon 6 A to C at 859 Met to Leu at 243 (ATG to CTG)
c.731T>A p.Met244Lys M244K exon 6 T to A at 863 Met to Lys at 244
c.742_743insTACA p.Arg248IlefsX? 874Ins TACA exon 6 Insertion of 4 bp (TACA) at 874 stop codon at amino acid 257 in exon 6b
c.744-14_744-3del 876- 14del12 intron 6 deletion of 12 bp from 876- 14 mRNA splicing defect?
c.744-10_744-3del 876- 10del8 intron 6 deletion of 8 bp from 876- 10 mRNA splicing defect?
c.744-6_744-3delTTAC intron 6
c.-318_-314delAGGGA promoter
c.769G>A p.Glu257Lys E257K exon 7 901G>A
c.772A>G p.Arg258Gly R258G exon 7 A to G at 904 Arg to Gly at 258
c.773delG p.Arg258AsnfsX3 905delG exon 7 deletion of G at 905 frameshift
c.775delinsTCTTCCTCAGATTCATTGTGATTACCTCA p.Leu259SerfsX7 exon 7
c.803delA p.Asn268IlefsX17 935delA exon 7 deletion of A at 935 frameshift
c.805_806delAT p.Ile269ProfsX4 936delTA exon 7 deletion of TA from 936 frameshift
c.836_838delAAG p.Glu279del E278del exon 7 deletion of AAG from 965 deletion of Glu at 278
c.837A>T p.Glu279Asp E279D exon 7 A to T at 969 Glu to Asp at 279
c.837A>T p.Glu279Asp E279D exon 7 A to T at 969 Glu to Asp at 279
c.846A>T p.Glu282Asp E282D exon 7 978A>T
c.853A>T p.Ile285Phe I285F exon 7 A to T at 985 Ile to Phe at 285
c.857_858insA p.Asn287LysfsX21 989- 992insA exon 7 Insertion of A at 989- 992 Frameshift
c.859_863delAACTT p.Asn287LysfsX19 991del5 exon 7 deletion AACTT from 991 or CTTAA from 993 frameshift
c.861C>G p.Asn287Lys exon 7
c.862_869+1delTTAAGACAG p.Leu288fsX? 994del9 exon 7 deletion of TTAAGACAG from 994 mRNA splicing defect
c.868C>T p.Gln290X Q290X exon 7 C to T at 1000 Gln to Stop at 290
c.869+4A>C;c.861_865delCTTAA p.Asn287LysfsX21 1001+ 4A- >C+ 993delCTTAA intron 7 splicing
c.870-7_870-5delTTT 1002- 7delTTT intron 7 Deletion of TTT beginning at 1002- 7 Interference with splicing?
c.870-7_870-5delTTT intron 7
c.874G>A p.Glu292Lys E292K exon 8 G to A at 1006 Glu to Lys at 292
c.877C>A p.Leu293Met L293M exon 8 C to A at 1009 Leu to Met at 293
c.881_882delAA p.Lys294ThrfsX13 1013delAA exon 8 deletion of AA from 1013 frameshift
c.890G>A p.Arg297Gln R297Q exon 8 G to A at 1022 Arg to Gln at 297
c.895G>A p.Ala299Thr A299T exon 8 G to A at 1027 Ala to Thr at 299
c.913T>G p.Phe305Val F305V exon 8 T to G at 1045 Phe 305 Val
c.925G>A p.Ala309Thr A309T exon 8 G to A at 1057 Ala to Thr at 309
c.927delC p.Phe310SerfsX18 1058delC exon 8 deletion of C at 1058 frameshift
c.926C>T p.Ala309Val A309V exon 8 C to T at 1058 Ala to Val at 309
c.926C>G p.Ala309Gly A309G exon 8 C to G at 1058 Ala to Gly at 309
c.926C>A p.Ala309Asp A309D exon 8 C to A at 1058 Ala to Asp at 309
c.933_935delCTT p.Phe312del [delta]F311 exon 8 deletion of 3 bp between 1059 and 1069 deletion of Phe310, 311 or 312
c.933C>G p.Phe311Leu F311L exon 8 C to G at 1065 Phe to Leu at 311
c.940G>C p.Gly314Arg G314R exon 8 G to C at 1072 Gly to Arg at 314
c.941G>T p.Gly314Val G314V exon 8 G to T at 1073 Gly to Val at 314
c.941G>A p.Gly314Glu G314E exon 8 G to A at 1073 Gly to Glu at 314
c.948T>G p.Phe316Leu F316L exon 8 T to G at 1080 Phe to Leu at 316
c.948delT p.Phe316LeufsX12 1078delT exon 8 deletion of T at 1078 frameshift
c.950T>C p.Val317Ala V317A exon 8 T to C at 1082 Val to Ala at 317
c.955T>G p.Phe319Val exon 8
c.958T>G p.Leu320Val L320V exon 8 T to G at 1090 Leu to Val at 320 CAVD
c.959T>A p.Leu320X L320X exon 8 T to A at 1091 Leu to Stop at 320
c.960A>T p.Leu320Phe L320F exon 8 A to T at 1092 Leu to Phe at 320
c.964G>A p.Val322Met V322M (1096(G/A)) exon 8 G or A at 1096 sequence variation
c.965T>C p.Val322Ala V322A exon 8 T to C at 1097 Val to Ala at 322 (mutation?)
c.971C>T p.Pro324Leu P324L exon 8 C to T at 1103 Pro to Leu at 324
c.980T>G p.Leu327Arg L327R exon 8 T to G at 1112 Leu to Arg at 327
c.980delT p.Leu327GlnfsX42 1112delT exon 8 deletion of T at 1112 frameshift
c.987delA p.Gly330GlufsX39 1119delA exon 8 deletion of A at 1119 frameshift
c.988G>T p.Gly330X G330X exon 8 G to T at 1120 Gly to Stop at 330
c.992T>A p.Ile331Asn I331N exon 8 T to A at 1124 Ile to Asn at 331
c.997C>T p.Leu333Phe L333F exon 8 997C>T
c.1001G>T p.Arg334Leu R334L exon 8 G to T at 1133 Arg to Leu at 334
c.1001G>A p.Arg334Gln R334Q exon 8 G to A at 1133 Arg to Gln at 334
c.1006_1007insG p.Ile336SerfsX28 1138insG exon 8 insertion of G after 1138 frameshift
c.1006A>C p.Ile336Leu exon 8
c.1007T>A p.Ile336Lys I336K exon 8 T to A at 1139 Ile to Lys at 336
c.1012A>G p.Thr338Ala T338A exon 8 A to G at 1144 Thr to Ala at 338
c.1013C>T p.Thr338Ile T338I exon 8 C to T at 1145 Thr to Ile at 338
c.1016_1018del p.Thr339del [delta]T339 exon 8 deletion of 3 bp between 1148 and 1150 deletion of Thr at 1140
c.1018delA p.Ile340SerfsX29 1150delA exon 8 deletion of A at 1150 frameshift
c.1019T>A p.Ile340Asn I340N exon 8 T to A at 1151 Ile to Asn at 340
c.1008_1019dup12 p.Phe337_Ile340dup 1151ins12 exon 8 tandem duplication of 12 bp from position 1140 to position 1151 Insertion-duplication of 4 amino acids within the M6 domain (transmembrane domain)
c.1029delC p.Cys343X 1161delC exon 8 deletion of C at 1161 frameshift
c.1029_1030insG p.Ile344AspfsX20 1161insG exon 8 insertion of G after 1161 frameshift
c.1036C>T p.Leu346Leu exon 8
c.1037T>C p.Leu346Pro L346P exon 8 T to C at 1169 Leu to Pro at 346
c.1040G>T p.Arg347Leu R347L exon 8 G to T at 1172 Arg to Leu at 347
c.1042A>G p.Met348Val M348V exon 8 A to G at 1174 Met to Val at AS 348
c.1043T>A p.Met348Lys M348K exon 8 T to A at 1175 Met to Lys at 348
c.1046C>T p.Ala349Val A349V exon 8 C to T at 1178 Ala to Val at 349
c.1052C>T p.Thr351Ile T351I exon 8 C to T at 1184 Thr to Ile at 351
c.1053_1054delTC p.Arg352AlafsX11 1185delTC exon 8 Deletion of TC at 1185 Frameshift
c.1054C>G p.Arg352Gly R352G exon 8 C to G at 1186 Arg to Gly at 352
c.1055G>A p.Arg352Gln R352Q exon 8 G to A at 1187 Arg to Gln at 352
c.1057C>T p.Gln353X Q353X exon 8 C to T at 1189 Gln to Stop at 353
c.1059A>C p.Gln353His Q353H exon 8 A to C at 1191 Gln to His at 353
c.1069delG p.Ala357LeufsX12 1199delG exon 8 deletion of G at 1199 frameshift
c.[1075C>A;1079C>A] p.[Gln359Lys;Thr360Lys] Q359K/T360K exon 8 C to A at 1207 and C to A at 1211 Glu to Lys at 359 and Thr to Lys at 360
c.1076A>G p.Gln359Arg Q359R exon 8 A to G at 1208 Gln to Arg at 359
c.1081delT p.Trp361GlyfsX8 1213delT exon 8 deletion of T at 1213 frameshift
c.1083delG p.Trp361CysfsX8 1215delG exon 8 deletion of G at 1215 frameshift
c.1093_1094delCT p.Leu365TrpfsX16 1221delCT exon 8 deletion of CT from 1221 frameshift
c.1089_1091delinsAAT p.Asp363_Ser364delinsGluIle exon 8
c.1094T>C p.Leu365Pro L365P exon 8 T to C at 1226 Leu to Pro at 365
c.1111_1112ins6 p.Lys370_Ile371insThrLys 1243ins6 exon 8 insertion of ACAAAA after 1243 insertion of Asp and Lys after Lys370
c.1117-30_1117-29delTA 1249- 30delAT intron 8 deletion of AT from 1249- 30 mRNA splicing defect?
c.1117-27_1117-26delTA 1249- 27delTA intron 8 deletion of TA at 1249- 27 mRNA splicing defect?
c.1119T>G p.Asp373Glu D373E exon 9 T to G at 1251 Asp to Glu a 373
c.1125A>C p.Leu375Phe L375F exon 9 A to C at 1257 Leu to Phe at 375 (CUAVD)
c.1127_1128insA p.Gln378AlafsX4 1259insA exon 9 insertion of A after 1259 frameshift
c.1133A>G p.Gln378Arg Q378R exon 9 A to G at 1265 Gln to Arg at 378
c.1135G>A p.Glu379Lys E379K exon 9 G to A at 1267 Glu to Lys at 379
c.1135G>T p.Glu379X E379X exon 9 G to T at 1267 Glu to Stop at 379
c.1148T>C p.Leu383Ser L383S exon 9 T to C at 1280 Leu to Ser at 383
c.1149G>A L383L (1281G/A) exon 9 G or A at 1281 sequence variation
c.1152delA p.Glu384AspfsX4 1283delA exon 9 deletion of A at 1283 frameshift
c.1153_1154insAT p.Asn386IlefsX3 1288insTA exon 9 Insertion of TA at 1285 Or Insertion of AT at 1284 Frameshift
c.1157_1158insTA p.Leu387ThrfsX2 1289insTA exon 9 Insertion of TA at 1289 Frameshift
c.1159_1160delTT p.Leu387AsnfsX23 1291delTT exon 9 delete TT from 1291 Frame shift
c.1162_1168delACGACTA p.Thr388GlnfsX3 1294del7 exon 9 deletion of 7 bp from 1294 frameshift
c.1162_1163delACinsTA p.Thr388X T388X exon 9 AC to TA at 1294 Thr to Stop at 388
c.1175T>C p.Val392Ala V392A exon 9 T to C at 1307 Val to Ala at 392 CAVD
c.1175T>G p.Val392Gly V392G exon 9 T to G at 1307 Val to Gly at 392
c.1177delG p.Val393X 1309delG exon 9 deletion of G at 1309 frameshift
c.1196C>T p.Ala399Val I1328T exon 9 T to C at 4115 Thr to Ile at 1328
c.1196C>A p.Ala399Asp A399D exon 9 C to A at 1328 Ala to Asp at 399
c.1196C>T p.Ala399Val A399V exon 9 C to T at 1328 Ala to Val at 399
c.1209G>C p.Glu403Asp E403D exon 9 G to C at 1341 Glu to Asp at 403
c.1210-12T[5_9] poly- T tract variations intron 9 variable number (5T, 7T, 9T) of thymidines at the poly- T tract starting at position 1342- 6 sequence variation (3 variants of which IVS8-5T is affecting splicing of exon 9)
c.1210-2_1210-1delAG 1342- 2delAG intron 9 deletion of AG from 1342- 2 mRNA splicing defect
c.1210-1delG 1342- 1delG intron 9 Deletion of G at 1342- 1 Frameshift
c.1220A>T p.Glu407Val E407V exon 10 A to T at 1352 Glu to Val at 407
c.1220_1239delAATTATTTGAGAAAGCAAAA p.Glu407AlafsX4 exon 10
c.1227delT p.Phe409LeufsX33 exon 10
c.1234delG p.Ala412GlnfsX30 1366delG exon 10 deletion of G at 1366 frameshift
c.1240_1244delCAAAA p.Asn415X 1367del5 exon 10 deletion of CAAAA at 1367 frameshift
c.1235delC p.Ala412GlufsX30 1367delC exon 10 deletion of C at 1367 frameshift
c.1240C>T p.Gln414X Q414X exon 10 C to T at 1372 Gln to Stop at 414
c.1261A>G p.Thr421Ala exon 10
c.1270G>A p.Gly424Ser G424S exon 10 G to A at 1402 Gly to Ser at 424
c.1291A>G p.Ser431Gly S431G exon 10 A to G at 1423 Ser to Gly a 431
c.1310G>T p.Gly437Val exon 10
c.1312A>G p.Thr438Ala exon 10
c.1322T>C p.Leu441Pro exon 10
c.1324A>T p.Lys442X exon 10
c.1330_1331delAT p.Ile444X 1460delAT exon 10 deletion of AT from 1460 frameshift
c.1329_1330insAGAT p.Ile444ArgfsX3 1461ins4 exon 10 insertion of AGAT after 1461 frameshift
c.1331T>C p.Ile444Thr I444T exon 10 T to C at 1463 lle to Thr at 444
c.1331T>G p.Ile444Ser I444S exon 10 T to G at 1463 Ile to Ser at 444
c.1340delA p.Lys447ArgfsX2 1471delA exon 10 deletion of A at 1471 frameshift
c.1343T>G p.Ile448Arg exon 10
c.1353_1354insT p.Gln452SerfsX30 exon 10
c.1355A>C p.Gln452Pro Q452P exon 10 A to C at 1487 Gln to Pro at 452
c.1359_1361delGTT p.Leu454del [delta]L453 exon 10 deletion of 3 bp between 1488 and 1494 deletion of Leu at 452 or 454
c.1364C>A p.Ala455Glu A455E exon 10 C to A at 1496 Ala to Glu at 455
c.1365_1366delGG p.Val456CysfsX25 1497delGG exon 10 deletion of GG at 1497 frameshift
c.1366G>T p.Val456Phe V456F exon 10 G to T at 1498 Val to Phe at 456
c.1367T>C p.Val456Ala V456A exon 10 T to C at 1499 Val to Ala at 456 (sequence variation?)
c.1373delG p.Gly458AspfsX11 1504delG exon 10 deletion of G at 1504 frameshift
c.1373G>T p.Gly458Val G458V exon 10 G to T at 1505 Gly to Val at 458
c.1388G>T p.Gly463Val exon 10
c.1388G>T p.Gly463Val G463V exon 10 G to T at 1520
c.1392G>T p.Lys464Asn K464N exon 10 G to T at 1524 Lys to Asn at 464, mRNA splicing defect?
c.1397C>T p.Ser466Leu S466L exon 11 C to T at 1529 Ser to Leu at 466 (CBAVD)
c.1399C>T p.Leu467Phe 1531C/T (L467F) exon 11 C or T at 1531 sequence variation
c.1403T>C p.Leu468Pro L468P exon 11 T to C at 1535 Leu to Pro at 468
c.1405A>G p.Met469Val M469V exon 11 A to G 1537 Met to Val at 469
c.1408_1417delATGATTATGG p.Met470GlufsX54 1540del10 exon 11 deletion of 10bp after 1540 frameshift
c.1408A>G p.Met470Val M470V exon 11 A or G at 1540 sequence variation
c.1418delG p.Gly473GlufsX54 1548delG exon 11 deletion of G from 1548 - 1550 frameshift
c.1420G>A p.Glu474Lys E474K exon 11 G to A at 1552 Glu to Lys at 474
c.1433_1434delCA p.Ser478X 1565 del CA exon 11 deletion of CA from 1565 frameshift
c.1435G>T p.Glu479X E479X exon 11 G to T at 1567 Glu to Stop at 479
c.1438G>A p.Gly480Ser G480S exon 11 G to A at 1570 Gly to Ser at 480
c.1438G>T p.Gly480Cys G480C exon 11 G to T at 1570 Gly to Cys at 480
c.1439delG p.Gly480ValfsX47 1571delG exon 11 deletion of G at 1571 frameshift
c.1439G>A p.Gly480Asp G480D exon 11 G to A at 1571 Gly to Asp at 480
c.1444_1445insT p.Lys483X 1576insT exon 11 insertion of T at 1576 framshift
c.1456G>T p.Gly486X G486X exon 11 G to T at 1588 Gly to Stop at 486
c.1469_1470delTC p.Phe490LeufsX13 1601delTC exon 11 deletion of TC from 1601 or CT from 1602 frameshift
c.1469delT p.Phe490Serfs*37 exon 11
c.1477_1478delCA p.Gln493ValfsX10 1609delCA exon 11 deletion of CA from 1609 frameshift
c.1477C>T p.Gln493X Q493X exon 11 C to T at 1609 Gln to Stop at 493
c.1478A>C p.Gln493Pro Q493P exon 11 A to C at 1610 Gln to Pro at 493
c.1478A>G p.Gln493Arg Q493R exon 11 A to G at 1610 Gln to Arg at 493
c.1482_1483delTT p.Ser495LeufsX8 1612delTT exon 11 deletion of TT from 1612 frameshift
c.1489A>G p.Ile497Val I497V exon 11 A to G at 1621 Ile to Val at 497
c.1494G>C p.Met498Ile M498I exon 11 G to C at 1626 Met (ATG) to Ileu (ATC) at 498
c.1495C>G p.Pro499Ala P499A exon 11 C to G at 1627 Pro to Ala at 499 (CBAVD)
c.1501A>G p.Thr501Ala T501A exon 11 A to G at 1633 Thr to Ala at 501
c.1505T>C p.Ile502Thr I502T exon 11 T to C at 1637 Ile to Thr at 502
c.1505T>A p.Ile502Asn I502N exon 11 T to A at 1637 Ile to Asn at 502
c.1510G>T p.Glu504X E504X exon 11 G to T at 1642 Glu to Stop at 504
c.1510G>C p.Glu504Gln E504Q exon 11 G to C at 1642 Glu to Gln at 504
c.1519_1521delATC p.Ile507del [delta]I507 exon 11 deletion of 3 bp between 1648 and 1653 deletion of Ile506 or Ile507
c.1516A>C p.Ile506Leu I506L exon 11 A to C at 1648 Ile to Leu at 506
c.1516A>G p.Ile506Val I506V (1648A/G) exon 11 A or G at 1648 Ile or Val at 506
c.1517T>G p.Ile506Ser I506S exon 11 T to G at 1649 Ile to Ser at 506
c.1517T>C p.Ile506Thr I506T exon 11 T to C at 1649 Ile to Thr at 506
c.1518C>G p.Ile506Met 1650C/G exon 11 C to G at 1650 Ile to Met at 506; sequence variation
c.1519A>G p.Ile507Val 1651A/G exon 11 A or G at 1651 sequence variation
c.1521_1523delCTT p.Phe508del [delta]F508 exon 11 deletion of 3 bp between 1652 and 1655 deletion of Phe at 508
c.1521C>G p.Ile507Met exon 11
c.1528delG p.Val510PhefsX17 1660delG exon 11 Deletion of G at 1660 frameshift
c.1538A>G p.Asp513Gly D513G exon 11 A to G at 1670 Asp to Gly at 513 (CBAVD)
c.1545_1546delTA p.Tyr515X 1677delTA exon 11 deletion of TA from 1677 frameshift
c.1546A>G p.Arg516Gly R516G exon 11 A to G at 1678 Arg to Gly at 516
c.1555A>G p.Ser519Gly S519G exon 11 A to G at 1687 Ser to Gly at 519
c.1558G>A p.Val520Ile V520I exon 11 G to A at 1690 Val to Ile at 520
c.1558G>T p.Val520Phe V520F exon 11 G to T at 1690 Val to Phe at 520
c.1561A>C p.Ile521Leu 1693A- >C exon 11 A to C at 1693 Ile to Leu at 521 (sequence variation?)
c.1561A>T p.Ile521Phe exon 11
c.1567G>T p.Ala523Ser exon 11
c.1573C>T p.Gln525X Q525X exon 11 C to T at 1705 Gln to Stop at 525
c.1574_1590delAACTAGAAGAGGACATC p.Gln525LeufsX37 1706del17 exon 11 deletion of 17 bp from 1706 deletion of splice site
c.1579G>C p.Glu527Gln E527Q exon 11 G to C at 1711 Glu to Gln at 527
c.1580A>G p.Glu527Gly E527G exon 11 A to G at 1712 Glu to Gly at 527
c.1582G>A p.Glu528Lys E528K exon 11 G to A at 1714 Glu to Lys at 528
c.1584G>T p.Glu528Asp E528D exon 11 G to T at 1716 Glu to Asp at 528 (splice mutation?)
c.1586A>G p.Asp529Gly D529G exon 12 A to G at 1718 Asp to Gly at 529
c.1588A>C p.Ile530Leu exon 12
c.1601C>A p.Ala534Glu A534E exon 12 C to A at 1733 Ala to Glu at 534
c.1606A>T p.Lys536X K536X exon 12 A to T at 1738 Lys to Stop codon at 536
c.1606A>G p.Lys536Glu K536E exon 12 A to G at 1738
c.1610_1611delAC p.Asp537GlufsX30 1742delAC exon 12 deletion of AC from 1742 frameshift
c.1611C>A p.Asp537Glu D537E exon 12 C to A or C to G at 1743 Asp to Glu at 537
c.1616T>C p.Ile539Thr I539T exon 12 T to C at 1748 Ile to Thr at 539
c.1617_1618insTA p.Val540X 1749insTA exon 12 insertion of TA at 1749 frameshift resulting in premature termination at 540
c.1622T>C p.Leu541Pro exon 12
c.1624G>T p.Gly542X G542X exon 12 G to T at 1756 Gly to Stop at 542
c.1625G>A p.Gly542Glu G542E exon 12 1757G>A
c.1630G>A p.Gly544Ser G544S exon 12 G to A at 1762 Gly to Ser at 544
c.1631G>T p.Gly544Val G544V exon 12 G to T at 1763 Gly to Val at 544 (CBAVD)
c.1635_1640del p.Ile546_Thr547del 1767del6 exon 12 delete 6 nucleotide from 1767 In frame in/del
c.1642_1643delCT p.Leu548GlufsX19 1774delCT exon 12 deletion of CT from 1774 frameshift
c.1643T>A p.Leu548Gln L548Q exon 12 T to A at 1775 Leu to Gln at 548
c.1645_1648delAGTG p.Ser549GlufsX9 exon 12
c.1646G>T p.Ser549Ile S549I exon 12 G to T at 1778 Ser to Ile at 549
c.1648G>A p.Gly550Arg G550R exon 12 G to A at 1780 Gly to Arg at 550
c.1648G>T p.Gly550X G550X exon 12 G to T at 1780 Gly to Stop at 550
c.1650delA p.Gly551ValfsX8 1782delA exon 12 deletion of A at 1782 frameshift
c.1651G>A p.Gly551Ser G551S exon 12 G to A at 1783 Gly to Ser at 551
c.1652delG p.Gly551ValfsX8 1784delG exon 12 deletion of G at 1784 frameshift
c.1652G>A p.Gly551Asp G551D exon 12 G to A at 1784 Gly to Asp at 551
c.1654C>A p.Gln552Lys Q552K exon 12 C to A at 1786 Gln to Lys at 552
c.1654C>T p.Gln552X Q552X exon 12 C to T at 1786 Gln to Stop at 552
c.1656delA p.Gln552HisfsX7 1787delA exon 12 deletion of A at position 1787 or 1788 frameshift, stop codon at 558
c.1657C>G p.Arg553Gly R553G exon 12 C to G at 1789 Arg to Gly at 553
c.1658G>A p.Arg553Gln R553Q exon 12 G to A at 1790 Arg to Gln at 553 (associated with [delta]F508;
c.1660_1661insA p.Ala554AspfsX14 exon 12
c.1663A>G p.Arg555Gly R555G exon 12 A to G at 1795 Arg to Gly at 555
c.1666A>G p.Ile556Val I556V exon 12 A to G at 1798 Ile to Val at 556 (mutation?)
c.1670delC p.Ser557PhefsX2 1802delC exon 12 deletion of C at 1802 frameshift
c.1673T>C p.Leu558Ser L558S exon 12 T to C at 1805 Leu to Ser at 558
c.1674delA p.Ala559GlnfsX13 1806delA exon 12 deletion of A at 1806 frameshift
c.1675G>A p.Ala559Thr A559T exon 12 G to A at 1807 Ala to Thr at 559
c.1676C>A p.Ala559Glu A559E exon 12 C to A at 1808 Ala to Glu at 559
c.1676C>T p.Ala559Val A559V exon 12 C to T at 1808 Ala to Val at 559
c.1678A>G p.Arg560Gly R560G exon 12 A to G at 1810 Ala to Gly at 560
c.1679G>A p.Arg560Lys R560K exon 12 G to A at 1811 Arg to Lys at 560
c.1681_1682insC p.Val562SerfsX6 1813insC exon 13 insertion of C after 1813 (or 1814) frameshift
c.1682C>A p.Ala561Glu A561E exon 13 C to A at 1814 Ala to Glu at 561
c.1684G>C p.Val562Leu V562L exon 13 G to C at 1816 Val to Leu at 562
c.1684G>A p.Val562Ile V562I exon 13 G to A at 1816 Val to Ile at 562
c.1690A>G p.Lys564Glu exon 13 A to G at 1690
c.1692delA p.Asp565MetfsX7 1824delA exon 13 1824delA
c.1694A>G p.Asp565Gly D565G exon 13 A to G at 1826 Asp to Gly at 565
c.1696G>A p.Ala566Thr A566T exon 13 G to A at 1828 Ala to Thr at 566
c.1700A>G p.Asp567Gly exon 13
c.1703delT p.Leu568CysfsX4 1833delT exon 13 deletion of T at 1833 frameshift
c.1703T>A p.Leu568X L568X exon 13 T to A at 1835 Leu to Stop at 568
c.1704G>T p.Leu568Phe L568F exon 13 G to T at 1836 Leu to Phe at 568 (CBAVD?)
c.1712T>C p.Leu571Ser L571S exon 13 T to C at 1844 Leu to Ser at 571
c.1713_1714delAG p.Asp572LeufsX16 1845delAG/1846delGA exon 13 deletion of AG at 1845 or GA at 1846 frameshift
c.1726G>T p.Gly576X G576X exon 13 G to T at 1858 Gly to Stop at 576
c.1727G>C p.Gly576Ala G576A exon 13 G to C at 1859 Gly to Ala at 576 (CAVD)
c.1736A>G p.Asp579Gly D579G exon 13 A to G at 1868 Asp to Gly at 579
c.1736A>C p.Asp579Ala D579A exon 13 A to C at 1868 Asp to Ala at 579
c.1738delG p.Val580PhefsX2 1870delG exon 13 deletion of G at 1870 frameshift
c.1739_1740insT p.Leu581PhefsX8 1874insT exon 13 insertion of T between 1871 and 1874 frameshift
c.1745C>T p.Thr582Ile T582I exon 13 C to T at 1877 Thr to Ile at 582
c.1753G>T p.Glu585X E585X exon 13 G to T at 1885 Glu to Stop at 585
c.1756A>G p.Ile586Val I586V exon 13 A to G at 1888 Ile to Val at 586
c.1759T>A p.Phe587Ile F587I exon 13 T to A at 1891 Phe to Ile at 587
c.1763A>T p.Glu588Val E588V exon 13 A to T at 1895 Glu to Val at 588
c.1766G>T p.Ser589Ile S589I exon 13 G to T at 1898 Ser to Ile at 589 (splicing?)
c.1781T>C p.Leu594Pro L594P exon 14 T to C at 1913 Leu to Pro at 594
c.1783A>G p.Met595Val exon 14
c.1785G>A p.Met595Ile M595I exon 14 G to A at 1917 Met to Ile at 595
c.1786_1787delGC p.Ala596X 1918delGC exon 14 deletion of GC from 1918 frameshift
c.1792_1798delAAAACTA p.Lys598GlyfsX11 1924del7 exon 14 deletion of 7 bp (AAACTA) from 1924 frameshift
c.1792A>T p.Lys598X K598X exon 14 A to T at 1924 Lys to Stop at 598
c.1798A>G p.Arg600Gly R600G exon 14 A to G at 1930 Arg to Gly at 600
c.1800delG p.Ile601PhefsX10 1932delG exon 14 Deletion of G at nucleotide 1932 Frameshift a premature stop codon appears 10 codons further.
c.1801A>T p.Ile601Phe I601F exon 14 A to T at 1933 Ile to Phe at 601
c.1807G>T p.Val603Phe V603F exon 14 G to T at 1939 Val to Phe at 603
c.1811C>T p.Thr604Ile T604I exon 14 C to T at 1943 Thr to Ile at 604
c.1817_1900delAAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC p.Met607_Gln634del 1949del84 exon 14 deletion of 84 bp from 1949 deletion of 28 a.a. (Met607 to Gln634)
c.1823A>G p.Glu608Gly E608G exon 14 A to G at 1955 Glu to Gly at 608
c.1826A>T p.His609Leu H609L exon 14 A to T at 1958 His to Leu at 609
c.1829T>C p.Leu610Ser L610S exon 14 T to C at 1961 Leu to Ser at 610
c.1837G>A p.Ala613Thr A613T exon 14 G to A at 1969 Ala to Thr at 613
c.1841A>G p.Asp614Gly D614G exon 14 A to G at 1973 Asp to Gly at 614
c.1853T>C p.Ile618Thr I618T exon 14 T to C at 1985 Ile to Thr at 618
c.1856T>C p.Leu619Ser L619S exon 14 T to C at 1988 Leu to Ser at 619
c.1860T>G p.His620Gln H620Q exon 14 T to G at 1992 His to Gln at 620
c.1865G>A p.Gly622Asp G622D exon 14 G to A at 1997 Gly to Asp at 622 (oligospermia)
c.1871_1878delGCTATTTT p.Ser624IlefsX15 2003del8 exon 14 Deletion of GCTATTTT from 2003 Frameshift
c.1882G>C p.Gly628Arg G628R(G- >C) exon 14 G to C at 2014 Gly to Arg at 628
c.1882G>A p.Gly628Arg G628R(G- >A) exon 14 G to A at 2014 Gly to Arg at 628
c.1897C>A p.Leu633Ile L633I exon 14 C to A at 2029 Leu to Ile at 633
c.1898T>C p.Leu633Pro L633P exon 14 T to C at 2030 Leu to Pro at 633
c.1900C>T p.Gln634X Q634X exon 14 C to T at 2032 Gln to Stop at 634
c.1907T>C p.Leu636Pro L636P exon 14 T to C at 2039 Leu to Pro at 636
c.1909C>T p.Gln637X Q637X exon 14 C to T at 2041 Gln to Stop at 637
c.1911delG p.Gln637HisfsX26 2043delG exon 14 deletion of G at 2043 frameshift
c.1919_1920delTT p.Phe640X 2051delTT exon 14 deletion of TT from 2051 frameshift
c.1920_1921dupTA p.Ser641IlefsX23 exon 14
c.1923_1931del9insA p.Ser641ArgfsX5 2055del9- >A exon 14 deletion of 9 bp CTCAAAACT to A at 2055 frameshift
c.1960A>G p.Ser654Gly 2092A/G exon 14 A or G at 2092 sequence variation
c.1966G>T p.Glu656X E656X exon 14 G to T at 2098 Glu to Stop at 656
c.1972_1973insA p.Arg658LysfsX7 2104insA+ 2109- 2118del10 exon 14 insertion of A at 2104, deletion of 10bp at 2109 ?
c.1973_1985del13insAGAAA p.Arg658LysfsX4 2105- 2117del13insAGAAA exon 14 Deletion of 13 bp and insertion of AGAAA at 2105- 2117 Frameshift
c.1976delA p.Asn659IlefsX4 2108delA exon 14 deletion of A at 2108 frameshift
c.1981delA p.Ile661SerfsX2 2113delA exon 14 deletion of A at 2113 frameshift
c.1984_1987delCTAA p.Thr663ArgfsX8 2116delCTAA exon 14 deletion of CTAA at 2116 frameshift
c.1986_1989delAACT p.Thr663ArgfsX8 2118del4 exon 14 deletion of AACT from 2118 frameshift
c.1990G>T p.Glu664X E664X exon 14 G to T at 2122 Glu to Stop at 664
c.2009_2010insA p.Leu671IlefsX18 2141insA exon 14 insertion of A after 2141 frameshift
c.2012delT p.Leu671X 2143delT exon 14 deletion of T at 2143 frameshift
c.2013_2015delAGA p.Glu672del E672del exon 14 deletion of 3 bp between 2145- 2148 deletion of Glu at 672
c.2017G>T p.Gly673X G673X exon 14 G to T at 2149 Gly to Stop at 673
c.2021A>T p.Asp674Val D674V exon 14 A to T at 2153 Asp to Val at 674
c.2044_2045insC p.Gln685ThrfsX4 2176insC exon 14 insertion of C after 2176 frameshift
c.2044delA p.Thr682GlnfsX40 exon 14
c.2048A>G p.Lys683Arg K683R exon 14 A to G at 2180 Lys to Arg at 683
c.2051_2052delAA p.Lys684ThrfsX4 2183delAA exon 14 deletion of AA at 2183 frameshift
c.2051_2052delAAinsG p.Lys684SerfsX38 2183AA- >G exon 14 A to G at 2183 and deletion of A at 2184 frameshift
c.2052delA p.Lys684AsnfsX38 2184delA exon 14 deletion of A at 2184 frameshift
c.2052_2053insA p.Gln685ThrfsX4 2184insA exon 14 insertion of A after 2184 frameshift
c.2053C>T p.Gln685X Q685X exon 14 C to T at 2185 Gln to Stop at 685
c.2053_2054insC p.Gln685ProfsX4 2185insC exon 14 insertion of C at 2185 frameshift
c.2061_2062insTTTT p.Lys688PhefsX? 2193ins4 exon 14 Insertion of 4T at 2193 Frameshift
c.2062A>T p.Lys688X K688X exon 14 A toT at 2194 Lys to Stop at 688
c.2065C>T p.Gln689X Q689X exon 14 C to T at 2197 Gln to Stop at 689
c.2074G>T p.Glu692X E692X exon 14 G to T at 2206 Glu to Stop at 692
c.2077T>C p.Phe693Leu F693L(CTT) exon 14 T to C at 2209 Phe to Leu at 693
c.2079T>G p.Phe693Leu F693L(TTG) exon 14 T to G at 2211 Phe to Leu at 693
c.2083_2084insG p.Glu695GlyfsX35 2215insG exon 14 insertion of G at 2215 frameshift
c.2087A>G p.Lys696Arg exon 14
c.2089_2090insA p.Arg697LysfsX33 2221insA exon 14 insertion of A at 2221 Frameshift a premature stop codon appears 33 codons further
c.2126G>A p.Arg709Gln R709Q exon 14 G to A at 2258 Arg to Gln at 709
c.2128A>T p.Lys710X K710X exon 14 A to T at 2260 Lys to Stop at 710
c.2143C>T p.Gln715X Q715X exon 14 C to T at 2275 Gln to Stop at 715
c.2145_2146delAAinsGT p.Lys716X K716X exon 14 AA to GT at 2277 and 2278 Lys to Stop at 716
c.2156T>A p.Leu719X L719X exon 14 T to A at 2288 Leu to Stop at 719
c.2157_2163delinsGT p.Gln720MetfsX11 2289- 2295del7bpinsGT exon 14 Deletion of 7 bp and insertion of GT at 2289- 2295 Frameshift
c.2158C>T p.Gln720X Q720X exon 14 C to T at 2290 Gln to Stop at 720
c.2168G>T p.Gly723Val G723V exon 14 G to T at 2300 Gly to Val at 723
c.2173G>A p.Glu725Lys E725K exon 14 G to A at 2305 Glu to Lys at 725
c.2175_2176insA p.Glu726ArgfsX4 2307insA exon 14 insertion of A after 2307 frameshift
c.2188G>T p.Glu730X E730X exon 14 G to T at 2320 Glu to Stop at 730
c.2195T>G p.Leu732X L732X exon 14 T to G at 2327 Leu to Stop at 732
c.2203delA p.Arg735GlyfsX4 2335delA exon 14 deletion of A at 2335 frameshift
c.2204G>A p.Arg735Lys R735K exon 14 G to A at 2336 Arg to Lys at 735
c.2215delG p.Val739TyrfsX16 2347delG exon 14 deletion of G at 2347 frameshift
c.2233G>T p.Gly745X G745X(Gly745X) exon 14 G to T at 2365 Non-sense mutation
c.2240_2247delCGATACTG p.Ile748SerfsX28 2372del8 exon 14 deletion of 8 bp from 2372 frameshift
c.2248_2255del p.Pro750GlnfsX26 2380_2387del exon 14 Deletion of 8 bp from 2380 Frameshift
c.2249C>T p.Pro750Leu P750L exon 14 C to T at 2381 Pro to Leu at 750
c.2255T>G p.Ile752Ser I752S exon 14 T to G at 2387 (ATC- >AGC) Ileu to Ser at 752
c.2260G>A p.Val754Met V754M exon 14 G to A at 2392 Val to Met at 754
c.2276_2277delCC p.Pro759HisfsX19 2406delCC exon 14 deletion of CC at 2406 Frameshift
c.2277delC p.Thr760ArgfsX11 2409delC exon 14 Deletion of C at 2409 Frameshift
c.2286G>T p.Gln762His 2418GG>T exon 14 G to T at 2418 missense
c.2291delG p.Arg764GlnfsX7 2423delG exon 14 deletion of G at 2423 frameshift
c.2324_2325delAC p.His775LeufsX3 2456delAC exon 14 deletion of AC at 2456 frameshift
c.2341C>T p.Gln781X Q781X exon 14 C to T at 2473 Gln to Stop at 781
c.2346C>A p.Asn782Lys N782K exon 14 C to A at 2478 Asn to Lys at 782
c.2363C>T p.Thr788Ile T788I exon 14 C to T at 2495 Thr to Ile at 788
c.2374C>G p.Arg792Gly R792G exon 14 C to G at 2506 Arg to Gly at 792
c.2380delG p.Val794CysfsX9 2512delG exon 14 Deletion of G at 2512 Frameshift
c.2390_2391insC p.Gln799SerfsX6 2522insC exon 14 insertion of C after 2522 frameshift
c.2399C>G p.Ala800Gly A800G exon 14 C to G at 2531 Ala to Gly at 800
c.2417A>G p.Asp806Gly D806G exon 14 A to G at 2549 Asp to Gly at 806
c.2419A>G p.Ile807Val I807V exon 14 A to G at 2551 Ile to Val at 807
c.2421A>G p.Ile807Met I807M exon 14 A or G at 2553 sequence variation
c.2421A>G p.Ile807Met 2553A/G exon 14 A or G at 2553 sequence variation
c.2424_2425insAT p.Ser809IlefsX13 2556insAT exon 14 insertion of AT after 2556 frameshift
c.2428A>G p.Arg810Gly R810G exon 14 A to G at 2560 Arg to Gly at 810
c.2433_2437delinsATA p.Leu812TyrfsX10 exon 14
c.2434_2435insT p.Leu812PhefsX11 2566insT exon 14 insertion of T after 2566 frameshift
c.2440C>T p.Gln814X Q814X exon 14 C to T at 2572 Gln to Stop at 814
c.2450G>T p.Gly817Val exon 14
c.2453delT p.Leu818TrpfsX3 2585delT exon 14 deletion of T at 2585 stop codon at amino acid 820
c.2462_2463delGT p.Ser821ArgfsX4 exon 14
c.2464G>A p.Glu822Lys E822K exon 14 G to A at 2596 Glu to Lys at 822
c.2464G>T p.Glu822X E822X exon 14 G to T at 2596 Glu to Stop at 822
c.2467G>T p.Glu823X E823X exon 14 G to T at 2599 Glu to Stop at 823
c.2472delT p.Asn825ThrfsX5 2603delT exon 14 deletion of T at 2603/4 frameshift
c.2476G>A p.Glu826Lys E826K exon 14 G to A at 2608 Glu to Lys at 826
c.2479G>T p.Glu827X E827X exon 14 G to T at 2611 Glu to Stop at 827
c.2483A>G p.Asp828Gly D828G exon 14 A to G at 2615 Asp to Gly at 828
c.2487A>G L829L (2619A/G) exon 14 A or G at 2619 sequence variation
c.2488A>T p.Lys830X K830X exon 14 A to T at 2620 Lys to Stop at 830
c.2490+2_2490+7delTAGGTA 2622+ 2del6 intron 14 deletion of TAGGTA from 2622+ 2 mRNA splicing defect
c.2491G>T p.Glu831X E831X exon 15 G to T at 2623 Glu to Stop at 831
c.2502delT p.Phe834LeufsX10 2634delT exon 15 Deletion of T at 2634 frameshift
c.2502T>G p.Phe834Leu exon 15
c.2508delT p.Asp836GlufsX8 2640delT exon 15 deletion of T at 2640 frameshift
c.2519T>C p.Ile840Thr I840T exon 15 T to C at 2651 Ile to Thr at 840
c.2552G>T p.Arg851Leu R851L exon 15 G to T at 2684 Arg to Leu at 851
c.2562delT p.Val855SerfsX5 2694delT exon 15 deletion of T at 2694 frameshift
c.2563G>A p.Val855Ile V855I exon 15 G to A at 2695 Val to Ile at 855 (sequence variation?)
c.2566_2567insT p.His856LeufsX40 exon 15
c.2583delT p.Phe861LeufsX3 2711delT exon 15 deletion of T at 2711 frameshift
c.2579T>C p.Ile860Thr I860T exon 15 2711T>C
c.2589_2599delAATTTGGTGCT p.Ile864SerfsX28 2721del11 exon 15 deletion of 11 bp from 2721 frameshift
c.2591_2592delTT p.Ile864MetfsX31 2723delTT exon 15 deletion of TT from 2723 frameshift
c.2596T>G p.Cys866Gly C866R exon 15 T to G at 2728 Cys to Arg at 866
c.2600T>A p.Leu867X L867X exon 15 T to A at 2732 Leu to Stop at 867
c.2600_2601insA p.Val868SerfsX28 2732insA exon 15 insertion of A at 2732 frameshift
c.2602delG p.Val868X 2734G- >AT exon 15 Deletion of G at 2734 with insertion of AT frameshift
c.2615delC p.Ala872GlufsX34 2747delC exon 15 Deletion of C at nucleotide 2747 Frameshift a premature stop codon appears 34 codons further
c.2619+18_2619+23del IVS14a+ 17del5 intron 15 5 bp deletion between 2751+ 17 and 2751+ 24 sequence variation
c.2620-18delT intron 15
c.2629_2631delTCT p.Ser877del S877del exon 16 2761delTCT
c.2634_2641delGGTTGTGC p.Leu878PhefsX15 2766del8 exon 16 deletion of 8 bp from 2766 frameshift
c.2655_2670delAAACACTCCTCTTCAA p.Asn886ThrfsX15 2787del16 exon 16 - intron 16 Deletion of 16 nucleotides from 2787 Splicing mutation.
c.2657+3delG 2789+ 3delG intron 16 deletion of G at 2789+ 3 mRNA splicing defect
c.2668C>T p.Gln890X Q890X exon 17 C to T at 2800 Gln to Stop at 890
c.2669A>G p.Gln890Arg Q890R exon 17 A to G at 2801 Gln to Arg at 890
c.2672A>G p.Asp891Gly D891G exon 17 A to G at 2804 Asp to Gly at 891
c.2686_2687insT p.Thr896IlefsX3 exon 17
c.2687_2690delCTCAinsTGAGTACTATGAG p.Thr896IlefsX9 2819del4bpins13bp exon 17 delete 4bp(CTCA) at 2819, insert 13 bp (TGAGTACTATGAG) at 2819 Thr to Met at 896, His to Ser at 897, insertion of Thr, Met and Ser after 897
c.2687C>T p.Thr896Ile T896I exon 17 C to T at 2819 Thr to Ile at 896
c.2719A>G p.Ile907Val 2851A/G exon 17 A or G at 2851 Ile or Val at 907
c.2726G>T p.Ser909Ile 2858G/T exon 17 G or T at 2858 sequence variation
c.2735C>T p.Ser912Leu S912L exon 17 C to T at 2867 Ser to Leu at 912
c.2743G>C p.Val915Leu exon 17
c.2754T>G p.Ile918Met I918M exon 17 T to G at 2886 Ile to Met at 918
c.2758G>T p.Val920Leu V920L exon 17 G to T at 2890 Val to Leu at 920
c.2758G>A p.Val920Met V920M exon 17 G to A at 2890 Val to Met at 920
c.2762G>A p.Gly921Glu G921E exon 17 2894G>A
c.2764G>C p.Val922Leu V922L exon 17 G to C at 2896 Val to Leu at 922
c.2764_2765insAG p.Val922GlufsX2 2896insAG exon 17 insertion of AG after 2896 frameshift
c.2775_2776delTT p.Leu926AlafsX48 2907delTT exon 17 deletion of TT from 2907 frameshift
c.2777delT p.Leu926CysfsX16 2909delT exon 17 deletion of T at 2909 frameshift
c.2778G>T p.Leu926Phe exon 17
c.2780T>C p.Leu927Pro L927P exon 17 T to C at 2912 Leu to Pro at 927
c.2797A>G p.Arg933Gly R933G exon 17 A to G at 2929 Arg to Gly at 933
c.2803_2813delCTACCACTGGT p.Leu935AlafsX36 exon 17
c.2805_2810delinsTCAGA p.Leu941X exon 17
c.2810_2811insT p.Val938GlyfsX37 2942insT exon 17 insertion of T at 2942 frameshift resulting in premature termination at codon 974
c.2812G>C p.Val938Leu V938L exon 17 G to C at 2944 Val to Leu at 938
c.2813T>G p.Val938Gly V938G exon 17 T to G at 2945 Val to Gly at 938 (CAVD)
c.2816_2817delATinsC p.His439ProfsX 2948AT- >C exon 17 AT to C at 2948 frameshift resulting in premature termination at 2953
c.2825delT p.Ile942ThrfsX26 2957delT exon 17 2957delT
c.2834C>T p.Ser945Leu S945L exon 17 C to T at 2966 Ser to Leu at 945
c.2836A>T p.Lys946X K946X exon 17 A to T at 2968 Lys to Stop at 946
c.2846A>T p.His949Leu H949L exon 17 A to T at 2978 His to Leu at 949
c.2856G>C p.Met952Ile M952I exon 17 G to C at 2988 Met to Ile at 952 CBAVD mutation?
c.2859_2890delACATTCTGTTCTTCAAGCACCTATGTCAACCC p.Leu953PhefsX11 2991del32 exon 17 deletion of 32 bp from 2991 to 3022 frameshift
c.2875delG p.Ala959HisfsX9 3007delG exon 17 deletion of G at 3007 frameshift
c.2876C>T p.Ala959Val A959V exon 17 C to T at 3008 Ala to Val at 959
c.2876delC p.Ala959AspfsX9 exon 17
c.2883G>T p.Met961Ile M961I exon 17 G to T at 3015 Met to Ile at 961
c.2896delA p.Thr966ArgfsX2 3028delA exon 17 deletion of A at 3028 frameshift
c.2900T>C p.Leu967Ser L967S exon 17 T to C at 3032 Leu to Ser at 967 (oligospermia?)
c.2908+1085_3367+260del7201 CFTR- dele 16- 17a- 17b intron 17 - exon 20 3040+ 1085_3499+ 260del7201 Large in frame deletion removing exons 16,17a,17b
c.2908G>C p.Gly970Arg G970R exon 17 G to C at 3040 Gly to Arg at 970
c.2908G>A p.Gly970Ser G970S exon 17 G to A at 3040 Gly to Ser at 970
c.2909-11_2909-5del 3041- 11del7 intron 17 deletion of GTATATT at 3041- 11 mRNA splicing mutation?
c.2909delG p.Gly970ValfsX11 3041delG exon 18 deletion of G at 3041 frameshift
c.2909G>A p.Gly970Asp G970D exon 18 G to A at 3041 Gly to Asp at 970
c.2916_2917delTCinsAT p.Leu973Phe L973F exon 18 TC to AT at 3048 and 3049 Leu to Phe at 973 (CBAVD)
c.2918T>C p.Leu973Pro L973P exon 18 T to C at 3050 Leu to Pro at 973
c.2918T>A p.Leu973His L973H exon 18 T to A at 3050 Leu to His at 973
c.2924_2925delGA p.Arg975IlefsX10 3056delGA exon 18 deletion of GA from 3056 frameshift
c.2932A>T p.Lys978X exon 18
c.2932A>T p.Lys978X K978X exon 18 3064A>T
c.2936A>T p.Asp979Val D979V exon 18 A to T at 3068 Asp to Val at 979
c.2936A>C p.Asp979Ala D979A exon 18 A to C at 3068 Asp to Ala at 979 (CBAVD?)
c.2939T>A p.Ile980Lys I980K exon 18 T to A at 3071 Ile to Lys at 980
c.2940A>G p.Ile980Met I980M exon 18 A to G at 3072 Ile to Met at 980
c.2947_2948delTT p.Leu983GlyfsX2 3079delTT exon 18 deletion of TT from 3079 frameshift
c.2971A>G p.Ile991Val I991V exon 18 A to G at 3103 Ile to Val at 991
c.2978A>G p.Asp993Gly D993G exon 18 A to G at 3110 Asp to Gly at 993
c.2988+41delA 3120+ 41delA intron 18 Delete A at 3120+ 41 sequence variation
c.2991G>C p.Leu997Phe L997F exon 19 G or C at 3123 Leu or Phe at 997 (sequence variation)
c.2994_2997delATTA p.Ile1000X 3126del4 exon 19 deletion of ATTA from 3126 frameshift
c.2997_3000delAATT p.Ile1000X 3129del4 exon 19 deletion of 4 bp from 3129 frameshift
c.2998delA p.Ile1000LeufsX2 3130delA exon 19 Deletion of A at 3130 frameshift
c.2998_3012del p.Val1001_Ile1005del 3131del15 exon 19 deletion of 15 bp from 3130, 3131, or 3132 deletion of Val at 1001 to Ile at 1005
c.2998_3012del p.Ile1000_Ile1005del 3130del15 exon 19 delete 15 nucleotide at 3130 In fram in/del
c.3002_3003delTG p.Val1001AspfsX45 3132delTG exon 19 deletion of TG from 3132 frameshift
c.3007G>T p.Gly1003X G1003X exon 19 G to T at 3139 Gly to Stop at 1003
c.3008G>A p.Gly1003Glu G1003E exon 19 G to A at 3140 Gly to Glu at 1003
c.3009_3017delAGCTATAGC p.Ala1004_Ala1006del 3141del9 exon 19 del AGCTATAGC from 3141 Frameshift
c.3014T>G p.Ile1005Arg I1005R exon 19 T to G at 3146 Ile to Arg at 1005
c.3017C>A p.Ala1006Glu A1006E exon 19 C to A at 3149 Ala to Glu at 1006
c.3021delT p.Val1008SerfsX15 3152delT exon 19 delete T at 3152 frameshift
c.3021delT p.Val1008SerfsX15 3153delT exon 19 deletion of T at 3153 frameshift
c.3022delG p.Val1008SerfsX15 3154delG exon 19 deletion of G at 3154 frameshift
c.3023T>A p.Val1008Asp V1008D exon 19 T to A at 3155 Val to Asp at 1008
c.3025G>A p.Ala1009Thr A1009T exon 19 G to A at 3157 Ala to Thr at 1009
c.3038C>T p.Pro1013Leu P1013L exon 19 C to T at 3170 Pro to Leu at 1013
c.3039delC p.Tyr1014ThrfsX9 3171delC exon 19 deletion of C at 3171 frameshift resulting in premature termination at 1022
c.3039_3040insC p.Tyr1014LeufsX33 3171insC exon 19 insertion of C after 3171 frameshift
c.3041_3042delAC p.Ile1015LeufsX31 3173delAC exon 19 deletion of AC from 3173 frameshift
c.3059T>A p.Val1020Glu V1020E exon 19 T to A at 3191 Val to Glu at 1020
c.3061C>G p.Pro1021Ala P1021A exon 19 C to G at 3193 Pro to Ala at 1021
c.3063_3068delAGTGAT p.Ile1023_Val1024del 3195del6 exon 19 deletion of AGTGAT from 3195 to 3200 deletion of Val1022 and Ile1023
c.3064_3117delGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACCTCACAGCAA p.Val1022_Gln1039del 3196del54 exon 19 deletion of 54 bp from 3196 deletion of 18 aa from codon 1022
c.3067_3072delATAGTG p.Ile1023_Val1024del 3199del6 exon 19 deletion of ATAGTG from 3199 deletion of Ile at 1023 and Val at 1024
c.3068_3072delTAGTG p.Ile1023SerfsX22 3200_3204delTAGTG exon 19 Deletion of TAGTG from 3200 Frameshift
c.3068T>C p.Ile1023Thr I1023T exon 19 3200T>C
c.3074C>A p.Ala1025Asp A1025D exon 19 C to A at 3206 Substitution of alanine to aspartic acid at position 1025
c.3080T>C p.Ile1027Thr I1027T exon 19 T to C at 3212 Ile to Thr at 1027
c.3084G>T p.Met1028Ile M1028I exon 19 G to T at 3216 Met to Ile at 1028
c.3103C>T p.Gln1035X Q1035X exon 19 C to T at 3235 Nonsense mutation
c.3106delA p.Thr1036LeufsX? 3238delA exon 19 3238delA frameshift
c.3118C>T p.Leu1040Phe exon 19
c.3124C>T p.Gln1042X Q1042X exon 19 C to T at 3256 Gln to Stop at 1042
c.3131A>G p.Glu1044Gly exon 19
c.3139_3139+1delGG p.Gly1047GlnfsX28 3271delGG exon 19 deletion of GG at 3271 framshift for exon 17b, loss of splice site
c.3139G>C p.Gly1047Arg G1047R exon 19 G to C at 3271 Gly to Arg at 1047
c.3139+193_3139+198delTAAT intron 19
c.3140-54_3140-649del 3272- 54del704 intron 19 deletion of 704 bp from 3272- 54 deletion of exon 17b
c.3140G>A p.Gly1047Asp G1047D exon 20 G to A at 3272 Gly to Asp at 1047 and mRNA splicing defect? (CBAVD?)
c.3142A>G p.Arg1048Gly R1048G exon 20 A to G at 3274 Arg to Gly a 1048
c.3148C>G p.Pro1050Ala exon 20
c.3151A>G p.Ile1051Val I1051V exon 20 A to G at 3283 Ile to Val at 1051
c.3154T>G p.Phe1052Val F1052V exon 20 T to G at 3286 Phe to Val at 1052
c.3158C>T p.Thr1053Ile T1053I exon 20 C to T at 3290 Thr to Ile at 1053 (CBAVD?)
c.3161delA p.His1054LeufsX6 3293delA exon 20 deletion of A at 3293 frameshift
c.3161A>T p.His1054Leu H1054 L exon 20 A to T at 3293 His to Leu at 1054
c.3169A>G p.Thr1057Ala T1057A exon 20 A to G at 3301 Thr to Ala at 1057
c.3176T>G p.Leu1059X L1059X exon 20 T to G at 3308 Leu to Stop at 1059
c.3177A>G L1059L (3309A/G) exon 20 A or G at 3309 sequence variation
c.3179A>C p.Lys1060Thr K1060T exon 20 A to C at 3311 Lys to Thr at 1060
c.3181G>C p.Gly1061Arg G1061R exon 20 G to C at 3313 Gly to Arg at 1061
c.3193C>T p.Leu1065Phe L1065F exon 20 C to T at 3325 Leu to Phe at 1065
c.3194T>G p.Leu1065Arg L1065R exon 20 T to G at 3326 Leu to Arg at 1065
c.3194T>C p.Leu1065Pro L1065P exon 20 T to C at 3326 Leu to Pro at 1065
c.3197G>T p.Arg1066Leu R1066L exon 20 G to T at 3329 Arg to Leu at 1066
c.3199G>A p.Ala1067Thr A1067T exon 20 G to A at 3331 Ala to Thr at 1067
c.3199G>C p.Ala1067Pro A1067P exon 20 G to C at 3331 Ala en Pro at 1067
c.3199_3200delinsA p.Ala1067ThrfsX16 exon 20
c.3200C>G p.Ala1067Gly A1067G exon 20 C to G at 3332 Ala to Gly at 1067
c.3200C>A p.Ala1067Asp A1067D exon 20 C to A at 3332 Ala to Asp at 1067
c.3200C>T p.Ala1067Val A1067V exon 20 C to T at 3332 Ala to Val at 1067
c.3205G>A p.Gly1069Arg G1069R exon 20 G to A at 3337 Gly to Arg at 1069
c.3209G>A p.Arg1070Gln R1070Q exon 20 G to A at 3341 Arg to Gln at 1070
c.3211C>T p.Gln1071X Q1071X exon 20 C to T at 3343 Gln to Stop at 1071
c.3212A>C p.Gln1071Pro Q1071P exon 20 A to C at 3344 Gln to Pro at 1071
c.3213G>T p.Gln1071His Q1071H exon 20 G to T at 3345 Gln to His at 1071
c.3215C>T p.Pro1072Leu P1072L exon 20 C to T at 3347 Pro to Leu at 1072
c.3222T>A p.Phe1074Leu F1074L exon 20 T to A at 3354 Phe to Leu at 1074
c.3229_3230delCT p.Leu1077ValfsX78 3359delCT exon 20 deletion of CT from 3359 frameshift
c.3230T>C p.Leu1077Pro L1077P exon 20 T to C at 3362 Leu to Pro at 1077
c.3238A>C p.Lys1080Gln K1080Q exon 20 3370A>C
c.3239A>G p.Lys1080Arg K1080R exon 20 A to G at 3371 Lys to Arg at 1080
c.3241G>C p.Ala1081Pro A1081P exon 20 G to C at 3373 Ala to Pro at 1081
c.3256A>G p.Thr1086Ala T1086A exon 20 A to G at 3388 Thr to Ala at 1086
c.3257C>T p.Thr1086Ile T1086I exon 20 C to T at 3389 Thr to Ile at 1086
c.3259G>C p.Ala1087Pro A1087P exon 20 G to C at 3391 Ala to Pro at AS 1087
c.3263dupA p.Asn1088LysfsX68 exon 20
c.3264delC p.Trp1089GlyfsX13 3396delC exon 20 deletion of C at 3396 frameshift
c.3278T>C p.Leu1093Pro L1093P exon 20 T to C at 3410 Leu to Pro at 1093
c.3287delT p.Leu1096ArgfsX6 3419delT exon 20 deletion of T at 3419 frameshift
c.3287T>G p.Leu1096Arg L1096R exon 20 T to G at 3419 Leu to Arg at 1096
c.3291delC p.Trp1098GlyfsX4 3423delC exon 20 deletion of C at 3423 frameshift
c.3293G>T p.Trp1098Leu W1098L exon 20 G to T at 3425 Trp to Leu at 1098
c.3294delG p.Trp1098CysfsX4 3425delG exon 20 deletion of G at 3425 or 3426 frameshift
c.3299A>C p.Gln1100Pro Q1100P exon 20 A to C at 3431 Gln to Pro at 1100
c.3302T>A p.Met1101Lys M1101K exon 20 T to A at 3434 Met to Lys at 1101
c.3310G>T p.Glu1104X E1104X exon 20 G to T at 3442 Glu to Stop at 1104
c.3315delG p.Met1105IlefsX16 3447delG exon 20 Deleletion of G at 3447 Frameshift
c.3322G>C p.Val1108Leu V1108L exon 20 G to C at 3454 Val to Leu at 1108
c.3331T>C p.Phe1111Leu F1111L exon 20 3463T>C
c.3331_3332delinsA p.Phe1111ThrfsX10 exon 20
c.3364delA p.Thr1122GlnfsX12 3495delA exon 20 deletion of A at 3495 frameshift
c.3367G>C p.Gly1123Arg G1123R exon 20 G to C at 3499 Gly to Arg at 1123 mRNA splicing defect?
c.3371_3373delAAG p.Glu1124del E1123del exon 21 Deletion of AAG at 3503 - 3505 deletion of Glu at 1123
c.3380G>A p.Gly1127Glu G1127E exon 21 G to A at 3512 Gly to Glu at 1127
c.3386T>G p.Val1129Gly V1129G exon 21 T to G at 3518 Val to Gly at 1129
c.3386T>G p.Val1129Gly V1129G exon 21 3518T>G Val to Gly at 1129
c.3389G>C p.Gly1130Ala G1130A exon 21 G to C at 3521 Gly to Ala at 1130
c.3391A>G p.Ile1131Val 3523A- >G exon 21 A to G at 3523 Ile to Val at 1131
c.3400_3401delACinsGTA p.Thr1134Ala 3532AC- >GTA exon 21 AC to GTA from 3532 frameshift
c.3406G>A p.Ala1136Thr A1136T exon 21 G to A at 3538 Ala to Thr at 1136
c.3409A>G p.Met1137Val M1137V exon 21 A to G at 3541 Met to Val at 1137
c.3415A>G p.Ile1139Val I1139V exon 21 A to G at 3547 Ile to Val at 1139
c.3418_3420delATG p.Met1140del [delta]M1140 exon 21 deletion of 3 bp between 3550 and 3553 deletion of Met at 1140
c.3419T>A p.Met1140Lys M1140K exon 21 T to A at 3551 Met to Lys at 1140
c.3424_3425insAGTA p.Thr1142LysfsX15 3556insAGTA exon 21 insertion of AGTA after position 3556 frame shift
c.3425C>T p.Thr1142Ile T1142I exon 21 C to T at 3557 Thr to Ile at 1142
c.3430C>T p.Gln1144X Q1144X exon 21 C to T at 3562 Gln to Stop at 1144
c.3439G>A p.Val1147Ile V1147I exon 21 G to A at 3571 Val to Ile at 1147
c.3444C>A p.Asn1148Lys N1148K exon 21 C to A at 3576 Asn to Lys at 1148
c.3445delT p.Ser1149ProfsX3 3577delT exon 21 deletion of T at 3577 frameshift
c.3458T>A p.Val1153Glu V1153E exon 21 T to A at 3590 Val to Glu at 1153 (CBAVD)
c.3461A>G p.Asp1154Gly D1154G exon 21 A to G at 3593 Asp to Gly at 1154 (CBAVD)
c.3468G>T p.Leu1156Phe L1156F exon 21 G to T at 3600 Leu to Phe at 1156
c.3469-331_3469-295del37;3469-189_3717+3822del4260pb intron 21 - exon 22
c.3485_3486delGA p.Val1163LeufsX2 3617delGA exon 22 Deletion of GA from 3617 Frameshift
c.3485G>T p.Arg1162Leu 3617G/T exon 22 G or T at 3617 sequence variation
c.3490_3491insT p.Lys1165X 3622insT exon 22 insertion of T after 3622 frameshift
c.3494A>C p.Lys1165Thr exon 22
c.3497delT p.Phe1166SerfsX26 3629delT exon 22 Deletion of T at 3629 Frame shift
c.3503A>G p.Asp1168Gly D1168G exon 22 A to G at 3635 Asp to Gly at 1168
c.3528delC p.Lys1177SerfsX15 3659delC exon 22 deletion of C at 3659 frameshift
c.3529A>T p.Lys1177X K1177X exon 22 A to T at 3661 Lys to Stop at 1177 (premature termination)
c.3530delA p.Lys1177SerfsX15 3662delA exon 22 deletion of A at 3662 frameshift
c.3530A>G p.Lys1177Arg K1177R exon 22 A to G at 3662 Lys to Arg at 1177
c.3535_3538delACCA p.Thr1179AsnfsX12 3667del4 exon 22 deletion of 4 bp from 3667 frameshift
c.3535_3536insTCAA p.Thr1179IlefsX17 3667ins4 exon 22 insertion of TCAA after 3667 frameshift
c.3540delA p.Lys1180AsnfsX12 3670delA exon 22 deletion of A at 3670 frameshift
c.3556C>T p.Gln1186X Q1186X exon 22 C to T at 3688 Gln to Stop at 1186
c.3569T>A p.Val1190Asp V1190D exon 22 T to A at 3701 Val to Asp at 1190
c.3592delG p.Val1198X 3724delG exon 22 deletion of G at 3724 frameshift
c.3598delAinsTCT p.Lys1200SerfsX12 exon 22
c.3600A>G p.Asp1201MetfsX10 3732delA exon 22 deletion of A at 3732 and A to G at 3730 frameshift and Lys to Glu at 1200
c.3605delA p.Asp1202AlafsX9 3737delA exon 22 deletion of A at 3737 frameshift
c.3618_3619delAG p.Gly1208ProfsX56 3750delAG exon 22 deletion of AG from 3750 frameshift
c.3623delG p.Gly1208AlafsX3 3755delG exon 22 deletion of G between 3751 and 3755 frameshift
c.3629T>A p.Met1210Lys M1210K exon 22 T to A at 3761 Met to Lys at 1210
c.3630G>A p.Met1210Ile M1210I exon 22 G to A at 3762 Met to Ile at 1210
c.3634G>A p.Val1212Ile V1212I exon 22 G to A at 3766 Val to Ile at 1212
c.3634G>T p.Val1212Phe exon 22
c.3659delC p.Thr1220LysfsX8 3791delC exon 22 deletion of C at 3791 frameshift
c.3659C>T p.Thr1220Ile 3791C/T exon 22 C or T at 3791 sequence variation
c.3664_3665insTCAA p.Gly1222ValfsX44 exon 22
c.3674C>T p.Ala1225Val exon 22
c.3680T>C p.Leu1227Ser L1227S exon 22 T to C at 3812 Leu to Ser at 1227
c.3681A>G p.Leu1227Leu exon 22
c.3682G>A p.Glu1228Lys E1228K exon 22 G to A at 3814
c.3683A>G p.Glu1228Gly E1228G exon 22 A to G at 3815 Glu to Gly at 1228
c.3687C>A p.Asn1229Lys exon 22
c.3691delT p.Ser1231ProfsX4 3821delT exon 22 deletion of T at 3821 frameshift
c.3691delT p.Ser1231ProfsX4 3821- 3823del T exon 22 deletion of T at 3821- 3823 frameshift (Stop at 1234)
c.3689T>C p.Ile1230Thr I1230T exon 22 T to C at 3821 Ile to Thr at 1230
c.3700A>C p.Ile1234Leu I1234L exon 22 A to C at 3832 sequence variation
c.3700A>G p.Ile1234Val I1234V exon 22 A to G at 3832 Ile to Val at 1234
c.3709G>A p.Gly1237Ser G1237S exon 22 G to A at 3841 Gly to Ser at 1237
c.3712C>T p.Gln1238X Q1238X exon 22 C to T at 3844 Gln to Stop at 1238
c.3713A>G p.Gln1238Arg Q1238R exon 22 A to G at 3845 Gln to Arg at 1238
c.3719T>G p.Val1240Gly V1240G exon 23 T to G at 3851 Val to Gly at 1240
c.3728_3758del 3860ins31 exon 23 insertion of 31 bp after 3860 frameshift
c.3730G>A p.Gly1244Arg G1244R exon 23 G to A at 3862 Gly to Arg at 1244
c.3731G>A p.Gly1244Glu G1244E exon 23 G to A at 3863 Gly to Glu at 1244
c.3731G>T p.Gly1244Val G1244V exon 23 G to T at 3863 Gly to Val at 1244
c.3737C>T p.Thr1246Ile T1246I exon 23 C to T at 3869 Thr to Ile at 1246 (mutation?)
c.3739G>A p.Gly1247Arg G1247R(G- >A) exon 23 G to A at 3871 Gly to Arg at 1247
c.3739G>C p.Gly1247Arg G1247R(G- >C) exon 23 G to C at 3871 Gly to Arg at 1247
c.3744delA p.Lys1250ArgfsX9 3876delA exon 23 deletion of A at 3876 frameshift
c.3745G>A p.Gly1249Arg G1249R exon 23 G to A at 3877 Gly to Arg at 1249
c.3747delG p.Lys1250ArgfsX9 3878delG exon 23 deletion of G at 3878 frameshift mutation at 1249 and stop codon at 1258
c.3746G>A p.Gly1249Glu G1249E exon 23 G to A at 3878 Gly to Glu at 1249
c.3759G>C p.Leu1253Phe L1253F exon 23 3891G>C
c.3761T>G p.Leu1254X L1254X exon 23 T to G at 3893 Leu to Stop at 1254
c.3762A>T p.Leu1254Phe exon 23
c.3764C>T p.Ser1255Leu S1255L exon 23 C to T at 3896 Ser to Leu at 1255
c.3766_3767insC p.Leu1258PhefsX7 3898insC exon 23 insertion of C after 3898 frameshift
c.3767C>T p.Ala1256Val A1256V exon 23 3899C>T
c.3771T>G p.Phe1257Leu F1257L exon 23 T to G at 3903 Phe to Leu at 1257
c.3773_3774insT p.Leu1258PhefsX7 3905insT exon 23 insertion of T after 3905 frameshift
c.3774_3775insG p.Arg1259GlufsX6 3906insG exon 23 insertion of G after 3906 frameshift
c.3780_3782delACT p.Leu1261del [delta]L1260 exon 23 deletion of ACT from either 3909 or 3912 deletion of Leu at 1260 or 1261
c.3779T>G p.Leu1260Arg L1260R exon 23 T to G at 3911 Leu to Arg at 1260
c.3787A>G p.Thr1263Ala T1263A exon 23 A to G at 3919 Thr to Ala at 1263
c.3788C>T p.Thr1263Ile T1263I exon 23 C to T at 3920 Thr to Ile at 1263
c.3790_3799delGAAGGAGAAA p.Glu1264SerfsX11 3922del10- >C exon 23 deletion of 10 bp from 3922 and replacement with 3921 deletion of Glu1264 to Glu1266
c.3800T>A p.Ile1267Asn exon 23
c.3803A>G p.Gln1268Arg Q1268R exon 23 A to G at 3935 Gln to Arg at 1268
c.3806T>A p.Ile1269Asn I1269N exon 23 T to A at 3938 Ile to Asn at 1269
c.3816_3817delGT p.Ser1273LeufsX28 3944delGT exon 23 deletion of GT from 3944 frameshift
c.3829delA p.Ile1277X 3960- 3961delA exon 23 Deletion of A at 3960- 3961 Frameshift
c.3835_3836delTT p.Leu1279AlafsX22 exon 23
c.3837G>A p.Leu1279Leu exon 23
c.3841C>T p.Gln1281X Q1281X exon 23 C to T at 3973 Gln to Stop at 1281
c.3844T>G p.Trp1282Gly W1282G exon 23 T to G at 3976 Trp to Gly at 1282
c.3847A>G p.Arg1283Gly exon 23
c.3848G>A p.Arg1283Lys R1283K exon 23 G to A at 3980 Arg to Lys at 1283
c.3854C>T p.Ala1285Val exon 23
c.3855delC p.Phe1286LeufsX3 exon 23
c.3854C>T p.Ala1285Val A1285V exon 23 3986C>T
c.3871C>T p.Gln1291X Q1291X exon 23 C to T at 4003 Gln to Stop at 1291
c.3872A>G p.Gln1291Arg Q1291R exon 23 A to G at 4004 Gln to Arg at 1291
c.3873+23delA 4005+ 23delA intron 23 Deletion of A at 4005+ 23 Sequence variation? mRNA splicing defect?
c.3873+121T[6_8] 4005+ 121delTT intron 23 8T or 6T at 4005+ 121 sequence variation
c.3873G>C p.Gln1291His Q1291H exon 23 G to C at 4005 Gln to His at 1291; mRNA splicing defect (?)
c.3874-103delT 4006- 103delT intron 23 deletion of T at 4006- 103 sequence variation?
c.3874-61_3874-48del 4006- 61del14 intron 23 deletion of 14 bp from 4006- 61 to 4006- 47 mRNA splicing defect?
c.3874-46_3874-42delTATTT 4006- 46delTATTT intron 23 Deletion from 4006- 46 to 4006- 42 Splicing defect?
c.3874-19_3874-17delCTT 4006- 19del3 intron 23 deletion of 3 bp from 4006- 19 mRNA splicing defect?
c.3876delA p.Val1293TyrfsX35 4006delA exon 24 deletion of A at 4006 frameshift
c.3877G>A p.Val1293Ile V1293I exon 24 G to A at 4009 Val to Ile at 1293
c.3882_3885delTATT p.Ile1295PhefsX32 4010del4 exon 24 deletion of TATT from 4010 frameshift
c.3883delA p.Ile1295PhefsX33 4015delA exon 24 deletion of A at 4015 frameshift
c.3890_3891insT p.Gly1298TrpfsX4 4022insT exon 24 insertion of T at 4022 Frameshift.
c.3893G>C p.Gly1298Ala G1298A exon 24 4025G>C
c.3896C>T p.Thr1299Ile T1299I exon 24 C to T at 4028 Thr to Ile at 1299
c.3898T>C p.Phe1300Leu F1300L exon 24 T to C at 4030 Phe to Leu at 1300
c.3905A>G p.Lys1302Arg K1302R exon 24 A to G at 4037 (AAA- >AGA) Lys to Arg at 1302
c.3908delA p.Asn1303ThrfsX25 4040delA exon 24 deletion of A at 4040 frameshift
c.3908A>T p.Asn1303Ile N1303I exon 24 A to T at 4040 Asn to Ile at 1303
c.3908dupA p.Asn1303LysfsX6 exon 24
c.3909_3914del6insTGT p.Leu1304_Asp1305delinsVal1304 4041_4046del6insTGT exon 24 Deletion of nucleotides 4041 to 4046 and insertion of TGT deletion of Leu at 1304 and Asp at 1305, insertion of Val at 1304
c.3909C>G p.Asn1303Lys N1303K exon 24 C to G at 4041 Asn to Lys at 1303
c.3910T>A p.Leu1304Met exon 24
c.3915T>A p.Asp1305Glu D1305E exon 24 T to A at 4047 Asp to Glu at 1305
c.3922G>T p.Glu1308X E1308X exon 24 G to T at 4054 Glu to Stop at 1308
c.3925C>G p.Gln1309Glu exon 24
c.3927G>T p.Gln1309His Q1309H exon 24 G to T at 4059 Gln to His at 1309
c.3931A>G p.Ser1311Gly S1311R exon 24 A to C at 4063 or T to A or G at 4065 Ser to Arg at 1311
c.3932_3933delinsAATATG p.Ser1311LysfsX12 exon 24
c.3935A>G p.Asp1312Gly D1312G exon 24 A to G at 4067 Asp to Gly at 1312
c.3937C>A p.Gln1313Lys Q1313K exon 24 C to A at 4069 Gln to Lys at 1313
c.3937C>T p.Gln1313X Q1313X exon 24 C to T at 4069 Gln to Stop at 1313
c.3953T>C p.Val1318Ala V1318A exon 24 T to C at 4085 Val to Ala at 1318
c.3956C>A p.Ala1319Glu A1319E exon 24 C to A at 4088 Ala to Glu at 1319
c.3961G>C p.Glu1321Gln E1321Q exon 24 G to C at 4093 Glu to Gln at 1321
c.3964-78_4242+577del CFTRdele22, 23 exon 25 - exon 26 This deletion extends from nucleotide - 78 of intron 21 (the end of intron 21 being defined as - 1) to nucleotide + 577 of intron 23 (the beginning of intron 23 being defined as + 1) with a loss of 1532 nucelotides The loss of exons 22 and 23 was in-frame and was predicted to result in a CFTR protein lacking amino acids 1322 to 1414, this constitutes the carboxy terminal end of the newly defined nucleotide-binding domain (NBD) 2 of the protein
c.3971T>C p.Leu1324Pro L1324P exon 25 T to C at 4103 Leu to Pro at 1324
c.3976delT p.Ser1326LeufsX2 4108delT exon 25 deletion of T at 4108 frameshift
c.3982_3984delATAinsTT p.Ile1328LeufsX? 4114ATA- >TT exon 25 ATA to TT from 4114 Ile to Leu at 1328 and frameshift
c.3985G>C p.Glu1329Gln exon 25
c.3997G>T p.Gly1333Trp G1333W exon 25 4129G>T
c.4003C>T p.Leu1335Phe L1335F exon 25 C to T at 4135 Leu to Phe at 1335
c.4004T>C p.Leu1335Pro L1335P exon 25 T to C at 4136 Leu to Pro at 1335
c.4009T>G p.Phe1337Val F1337V exon 25 T to G at 4141 Phe to Val at 1337 (CBAVD)
c.4015C>T p.Leu1339Phe L1339F exon 25 C to T at 4147 Leu to Phe at 1339
c.4027G>A p.Gly1343Ser exon 25
c.4025_4028dupGGGG p.Cys1344GlyfsX16 exon 25
c.4036_4042del p.Leu1346MetfsX6 4168delCTAAGCC exon 25 Deletion of CTAAGCC at 4168
c.4039_4040insA p.Ser1347LysfsX12 4171insA exon 25 insertion of A at 4171 Frameshift a premature stop codon appears 12 codons further.
c.4040_4041delGC p.Ser1347ThrfsX11 4172delGC exon 25 deletion of GC from 4172 frameshift
c.4042delC p.His1348MetfsX6 4173delC exon 25 deletion of C at 4173 frameshift
c.4045G>A p.Gly1349Ser G1349S exon 25 G to A at 4177 Gly to Ser at 1349
c.4046G>A p.Gly1349Asp G1349D exon 25 G to A at 4178 Gly to Asp at 1349
c.4051A>G p.Lys1351Glu K1351E exon 25 A to G at 4183 Lys to Glu at 1351 (CBAVD)
c.4054C>G p.Gln1352Glu Q1352E exon 25 C to G at 4186 Gln to Glu at 1352
c.4056G>T p.Gln1352His Q1352H(G- >T) exon 25 G to T at 4188 Gln to His at 1352
c.4056G>C p.Gln1352His Q1352H(G- >C) exon 25 G to C at 4188 Gln to His at 1352
c.4071_4073delTAGinsAA p.Ala1357LeufsX? 4203TAG- >AA exon 25 TAG to AA at 4203 frameshift
c.4077_4080delTGTTinsAA p.Val1360delfsX? 4209TGTT- >AA exon 25 TGTT to AA from 4209 Frame shift
c.4086_4087insT p.Lys1363X 4218insT exon 25 insertion of T after 4218 frameshift
c.4091C>T p.Ala1364Val A1364V exon 25 C to T at 4223 Ala to Val at 1364 CBAVD
c.4097T>C p.Ile1366Thr I1366T exon 25 T to C at 4229 Ile to Thr at 1366
c.4105_4110delinsAGAA p.Ile1384X exon 25
c.4111G>T p.Glu1371X E1371X exon 25 G to T at 4243 Glu to Stop at 1371
c.4111_4113dupGAA p.Glu1371dup exon 25
c.4115C>T p.Pro1372Leu P1372 L exon 25 C to T at 4247 Pro to Leu at 1732
c.4127_4131delTGGAT p.Leu1376SerfsX8 exon 25
c.4139delC p.Thr1380AsnfsX4 4271delC exon 26 deletion of C at 4271 frameshift
c.4140delA p.Tyr1381ThrfsX3 4272delA exon 26 Deletion of nucleotide A at 4272 position Frameshift
c.4144C>T p.Gln1382X Q1382X exon 26 C to T at 4276 Gln to Stop at 1382
c.4147_4148insA p.Ile1383AsnfsX3 4279insA exon 26 insertion of A after 4279 frameshift
c.4162C>G p.Leu1388Val L1388V exon 26 C to G at 4294 Leu to Val at 1388
c.4163T>A p.Leu1388Gln L1388Q exon 26 T to A at 4295 Leu to Gln at 1388 (CBAVD)
c.4168C>T p.Gln1390X Q1390X exon 26 4300 C to T Gln to stop at 1390
c.4170delA p.Ala1391HisfsX7 4301(4302?)delA exon 26 deletion of A at 4301 or 4302 frameshift
c.4190T>A p.Val1397Glu V1397E exon 26 T to A at 4322 Val to Glu at 1397
c.4193T>G p.Ile1398Ser I1398S exon 26 T to G at 4325 Ile to Ser at 1398
c.4196_4197delTC p.Cys1400X 4326delTC exon 26 deletion of TC from 4326 frameshift
c.4196_4197delTC p.Cys1400X 4326delTC exon 26 Deletion of TC from 4326 to 4327 FrameShift
c.4197C>G p.Leu1399Leu exon 26
c.4200_4201delTG p.Cys1400X 4332delTG exon 26 deletion of TG at 4332 framshift
c.4201dupG p.Glu1401GlyfsX61 exon 26
c.4201G>A p.Glu1401Lys E1401K exon 26 G to A at 4333 Glu to Lys at 1401
c.4201G>T p.Glu1401X E1401X exon 26 G to T at 4333 Glu to Stop at 1401
c.4202A>C p.Glu1401Ala E1401A exon 26 A to C at 4334 Glu to Ala at 1401
c.4202A>G p.Glu1401Gly E1401G exon 26 A to G at 4334 Glu to Gly at 1401
c.4225G>A p.Glu1409Lys E1409K exon 26 G to A at 4357 Glu to Lys at 1409
c.4226A>T p.Glu1409Val E1409V exon 26 A to T at 4358 Glu to Val at 1409
c.4231C>T p.Gln1411X Q1411X exon 26 C to T at 4363 Gln to Stop at 1411
c.4234C>T p.Gln1412X Q1412X exon 26 C to T at 4366 Gln to Stop at 1412
c.4241T>C p.Leu1414Ser L1414S exon 26 T to C at 4373 Leu to Ser at 1414
c.4242_4242+1delGGinsTT p.Leu1414Phe 4374_4374+ 1GG>TT exon 26 - intron 26 4374_4374+ 1GG>TT mRNA splicing defect
c.4243-7delT 4375- 7delT intron 26
c.4251delA p.Glu1418ArgfsX14 4382delA exon 27 deletion of A at 4382 frameshift
c.4252G>T p.Glu1418X E1418X exon 27 G to T at 4384 (GAG- >TAG) Glu to Stop at 1418
c.4280T>C p.Ile427Thr I1427T exon 27 4412T>C
c.4296C>G p.Asn1432Lys N1432K exon 27 C to G at 4428 sequence variation
c.4296_4297insGA p.Ser1435GlyfsX14 4428insGA exon 27 insertion of GA after 4428 frameshift
c.4375A>A p.Lys1459Lys exon 27
c.4389G>T p.Gln1463His Q1463H exon 27 G to T at 4521 Gln to His a 1463
c.4404A>C p.Lys1468Asn exon 27 A to C 4404
c.4417G>T p.Glu1473X E1473X exon 27 G to T at 4549 Glu to Stop at 1473
c.4426C>T p.Gln1476X Q1476X exon 27 C to T at 4558 Gln to Stop at 1476
c.4439T>C p.Leu1480Pro L1480P exon 27 T to C at 4571 Leu to Pro a 1480
c.*33_63del31 4608- 4638del31 3'UTR 31bp deletion between 4608 and 4638 sequence variation?
c.4243-36delT 4375- 36delT intron 26 deletion of T at 4375- 36 sequence variation
c.(?_2620)_(3367_?)del CFTRdele14b- 17b exon 16 - exon 20 9890 bp deletion Removes 5 coding exons
c.2620-674_3367+198del 2752- 674_3499+ 198del9855 exon 16 - exon 20 2752- 674_3499+ 198del9855bp Large deletion removing exons 14b to 17b. Frameshift
c.(?_54)_(273_?)del Del exon 2- 3 intron 2 - exon 3 Deletion of exons 2, 3 Predicted truncation of the CFTR Protein
c.(?_274)_(743_?)del Del exon 4- 6a exon 4 - exon 6 Deletion of exons 4, 5, 6a Predicted truncation of the CFTR protein in TM1.
c.54+2909_870-1620del55429insGTACTCAACAGCTCTAG delEx2- 6b exon 2 - intron 7 185+ 2909_1002- 1620del55429ins17 ((insertion of GTACTCAACAGCTCTAG) The deletion of exons 2 to 6b is in frame and would lead to remove 272 residues.
c.(?_274)_(1116_?)del(?_1585)_(3468_?)del CFTR50kbdel exon 4 - exon 21 complex deletion involving exons 4- 7 and 11- 18 complex deletion
c.(?_-1270)_(53_?)del Del Pr- Ex1 promoter - exon 1 Deletion of Promoter, Exon 1 Predicted Removal of CFTR gene expression and ATG start Codon.
c.-12_10del23 120del23 promoter - exon 1 Deletion of 23 bp from nucleotide + 120 of exon 1 promoter, to nucleotide 142 (the first nucleotide of codon 4) This mutation abolishes the initiation codon at position 133. The next possible initiation codon is located at intron 1 position 185+63.
c.(?_-1270)_(164_?)del Del Pr- Ex1- Ex2 promoter - exon 2 Deletion of Promoter, Exon 1, Exon 2 Predicted Removal of CFTR gene expression and ATG start Codon.
c.(?_-1270)_(273_?)del delePr- 3 promoter - exon 3 Large deletion ? The consequence at RNA level remain to be studied
c.4_53+69delins299 CFTRdele1 exon 1 Deletion of exon 1 from nucleotide 136 (codons 2- 18) to intron 1 nucleotide + 69 and insertion of an inverted and complementary sequence of intron 1 (nucleotide 185+ 4191 to + 4488) and addition of a G at the junction. A small peptide of 17 residues if translation starts at the same ATG or another protein (possibly CFTR-like?) if another ATG is choosen.
c.4_53+69delins299 CFTRdele1Ins299bp exon 1 This indel involved the deletion of 119 bp extending from coding position 4 (A of the ATG- translation initiation codon being defined as 1) to IVS1+ 69 that removed nearly the entire coding sequence of exon 1, and the insertion of 299 bp at the deletion junction
c.4_53+69delins299 CFTRdele1 or 136del119ins299 exon 1 - intron 1 136_185+ 69del119bpins299bp Deletion of exon 1 from nucleotide 136 (codons 2-18) to intron 1 nucleotide +69 and insertion of an inverted and complementary sequence of intron 1 (nucleotide 185+4191 to +4488) and addition of a G at the junction. A small peptide of 17 residues if translation starts at the same ATG or another protein (possibly CFTR-like?) if another ATG is choosen.
c.53+9711_1393+2670del61634 delEx2- 9 exon 1 - intron 10 c.53+ 9?711_1392+ 2?670del61?634 Large deletion of exons 2-9 (intron 1 to intron 9), out of frame
c.(?_-1270)_(*1553_?)del CFTRdele1- 24 exon 1 - exon 27 deletion of the whole CFTR gene absence of CFTR expression.
c.54-5940_273+10250del21kb p.Ser18ArgfsX16 CFTRdele2, 3 intron 1 - exon 3 deletion of exons 2 and 3 frameshift
c.(?_54)_(164_?)del CFTRdele2 exon 2 deletion of exon 2 frameshift
c.(?_54)_(1584_?)del CFTRdele2- 10 exon 2 - exon 11 deletion of 95.7 kb starting in intron 1 frameshift
c.(?_165)_(1584_?)del(?_1620)_(2988_?)del CFTRdele3- 10, 14b- 16 exon 3 - exon 18 Complex deletion involving exons 3- 10 and 14b- 16 Complex deletion
c.(?_165)_(1584_?)del(?_1620)_(2988_?)del CFTRdele3- 10, 14b- 16 exon 3 - exon 18 Complex deletion involving exons 3- 10 and 14b- 16 Complex deletion
c.(?_274)_(489_?)delins41 CFTRdele4Ins41bp exon 4 Gross deletion of 8, 165 bp spanning exon 4, together with an insertion of 41 bp This deletion was in-frame and was predicted to lead to the synthesis of a protein lacking amino acids 92-163, a stretch that includes a part of TM1 and the the entire TM2
c.(?_274)_(743_?)delins6 CFTRdele4- 6aIns6bp exon 4 - exon 6 Deletion of 18, 654 bp encompassing exons 4, 5, and 6a, together with an insertion of 6 bp This large deletion disrupted the reading frame of the protein
c.(?_274)_(1584_?)del CFTR40kbdel exon 4 - exon 11 deletion of exons 4- 10 large deletion from intron 3 to intron 10
c.1360_1387del p.Leu454_Val456del 1491- 1500del exon 10 Deletion between 1491 to 1500 Large in/del
c.1393+12_2657+403delins 35 CFTRdele11- 16Ins35bp exon 12 - exon 18 Gross deletion of 47.5 kb going from IVS10+ 12 to IVS16+ 403 that removed exons 11 to 16 inclusive, together with an insertion of 35 bp The in-frame deletion of exons 11 to 16 was predicted to result in a protein lacking amino acids 529 to 996, this includes the carboxy terminal end of NBD1, the entire regulatory R domain and transmembrane-spanning regions TM7 and TM8.
c.(?_1767)_(2490_?)del CFTRdele14a exon 15 deletion of >=1.2 kb including exon 14a aberrant mRNA splicing
c.(?_2620)_(3468_?)del CFTRdele14b- 18 exon 16 - exon 21 deletion of 20 kb from exons 14b through 18 deletion of amino acids 874-1156
c.(?_2909)_(33367_?)del CFTRdele16- 17b exon 18 - exon 20 deletion of 7kb starting at intron 15 large deletion from intron 15 to intron 17b
c.2989-977_3367+248del 3121- 977_3499+ 248del2515 exon 19 - exon 20 3121- 977_3499+ 248del2515bp Large deletion removing exons 17a and 17b. Frameshift
c.(?_2989)_(3367_?)del Del exon 17a- 17b exon 19 - exon 20 Deletion of exons 17a- 17b Truncation of CFTR protein in TM2.
c.(?_2989)_(3468_?)del Del exon 17a- 17b- 18 exon 19 - exon 21 Deletion of exons 17a- 18 in-frame deletion, joining of exons 16 to 19, deletion of terminal domain of TM2.
c.33281_3367+268del355insTGTTAA 3413del355_insTGTTAA exon 20 Partial deletion of exon 17b. It removes 355 bp, i.e. from nt 3413 (in codon 1094) to 3499+ 268 in intron 17b; the sequence "TGTTAA" is inserted at the breakpoints. A stop codon appears very early in the new sequence but the consequences at the RNA level remain to be studied.
c.(?_3140)_(3468_?)del CFTRdele17b18 exon 20 - exon 21 deletion of exons 17b and 18 frameshift
c.(?_3469)_(3717_?)del5.3kb CFTRdele19 exon 22 deletion of 5.3kb, removing exon 19 ?
c.1297_1313del p.Ser429_Val440delfsX1 1429del7bp exon 22 deletion of 17bp from 1429 stop codon at amino acid 441
c.(?_3874)_(3963_?)del CFTRdele21 exon 24 deletion of exon 21 large deletion from exon 21
c.(?_3964)_(4242_?)del Del exon 22- 23 exon 25 - exon 26 Deletion of exons 22- 23 In-frame deletion that is predicted to remove the terminal part of NBD2
c.(?_3964)_(*1553_?)del Del exon 22- 24 exon 25 - exon 27 Deletion of Exons 22, 23, 24 Predicted Removal of terminal portion of CFTR protein




Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011